Open Close
General Information
Symbol
Dmel\px-RD
Species
D. melanogaster
Annotation Symbol
CG4444-RD
FlyBase ID
FBtr0331941
Feature type
Associated gene
Evidence Rank
Length (nt)
4365
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTCCTTTCGCAAACGTCGCCAGTGGCGTGTCTTCGGCTTTTGGTTTCTCGGCTTGCTGGCCAACGCTCTCTCTCCTGGC
        CAATTCGCACATTTTTTGGATTGCGCGATTAGCGGTTGCCAATTAAGGCGCGTGGTGCTCGAGTCTCGTGCTTGCGATTG
        TGAATGTGATTTTCGGTGCGTTACTGAGGGAGTGCTTGTGTGGGTGTCTCACCGTTTCAGTGTTGCGAGTGTTTGAGTGC
        GGAGGCGGCCGAGCGAATTGAATTACAATTACAGTTGTGATTACGATTACGAGATTGCAGTAATTATGGCCGCCACTTGA
        GGCGTGAGAATCGTGTGGGCGCCCGCAGAATTCGGCTGTCTAAAAGCCCTCGCCCTCGTCCATTTGCATTTCTTGGTGGA
        ACAAGTGCAGCAGCAGAAGCAGCAGCTCCAGCAAGCGTTAACCCCTCTGAAAGCGAAATAAAACGAAAAGCGGCAAAGTT
        TGAACCACCCCCCATAAACCCCCCAAAACAACCTCCAACCCCCCACCCAACACACTTGGAAGGCAAAAGTTTTCGGCGTG
        GAATTTAAATTGGAAAAGTAAAATGAAAAGAAAGGCGCTCGAGTAAAAGTTAAACAAAGTGCAAAGTAAATATTAAATTA
        AGAAAGCGAATAAGAAATACCAAAAAAAAAATATATATATAGCAAAGAAGAACAGGCGACGGCGAATTTTCGGTGCAGTG
        CAACAAAAGAAAAAGAAAATCCAGGAAGGAAGTGAAGTGGAGTGTAGCGAGCGGAAGAGAAAGGAGAAAGCAGCGCGGAG
        AACGCGTCGGCGGGTAGAGAAAACAACTTCCGCTTGCATCCTTCGTCTTGTGCCTCTTCTTCCTTTCATTAATGCCTTTC
        TCGCGAAAATCTGAACCTTTTGCACGCAGGTCGAGGCATCGTTTATAAAGTCCCCGCCCCCCAGCTGCCTGTTTTATTAT
        TCCGTTTCCTTGGATTAACTCAATTTGTTGTCCCGCGACGTAGTAAAAAAAAGGGAAAAACATCGCAGGGGAACCAGAAA
        ATAAAAGAAATCGAAGTACGAGTGGGGGAAAAAACAAAAGGATCCGAACTGAGATCCTGGAGCCAGGATTACGGGAACGC
        AAAGTGCAATCCAGTGCAGCCCAATACACACACTCTGCGGAAGAAAGAGAGCGCGTGAGTGTGCGAGAGAGACAGCCAGT
        GGCACCTTGCTCGGATTATAGCCCATAATAAATGATGGAATGGCTACCAAGAGGATTACCCAGCATCCATGCTCCGATAC
        CGATTTGTGTGCCGCCAAAGGCTGGACAGAAGCGGCCAGCCACCAGTCCGGCACCGCACATTCCCGTGCCGCACCACCTG
        CAAACTCCTCCTGGCGGCGGCGCCGGCGGCTTGCCGGGATCTTCGGTGGCAAACAGCCCGATTCCATCGTCCGCCGGTGG
        CAACGCCCTTATGAACCACGCCCTGCCCAACAATCACATTGGCACCCCGTCGCCACAGCAGCAGCATCAGCACCAGCAAC
        ATCAACAGCAACAGCAACAGCAGCAACACCAAGCTCAACAACAGGCACAACAACAGGCGGTGGCGGCTGCAGTGCAGCAA
        CAGCTGGCAGCCGGAGTGGGCTTGCCTCCAGGAGCTATTGGTGCCGCTTCGGCCAGTAGTCGAGGCTCCTTTGCCGCCGC
        CCTGCGAACGCTGGCCAAGCAAGCGGACATCAAGGAGGAGGATGTCGGTGGAGACAGAAGTGTGCCAACTTCGGGAGCCG
        GAGGACCACCGCCGTCGTCAAGTGGCCCAGGATCGCTGAATTCGGTGGCAGGCCGCGTGGGATCTGAGCGACCTGGCGAG
        GATCGAGTGTCTAGTAACAAGAAGCGATCACCTCCGTCGCCACAGCCGCCGGAGAAGATCGCCCGTCTGAGTCACACGCC
        ACAAACAGCATCGCTGCAACCGGAACTCTTAGCCAGGAGCGGTTTCCAGCCGTACAGATCGGACGAGCGATTGATGCATC
        CGGCAGGTGCCTTTCCGCTGGAGGCCTACTCTCACTTCGCCGGATTGCAGGGTATTCCGCCAGCTTTTCTGAATCCCGCT
        GGTCTACCGTATACGGAGCAGCTCTACTTGGAGCATAGATACCAACTGTTTCGGGCCGCCGGCGCACATCCCTCTCATCC
        GCATGCGGCTGCCCTGTATCCCCAAATGGCCTCGCCGTACTCCCACCTGTACTCGATGATGCCGGGAGCAGCGTTGGGTA
        TCTCGCCAGCGATGCACGACCGGATGAAGCTGGAGGAGGAGCACCGGGCGCGATTGGCGAGGGAGGAGGAACGCGAACGA
        GAGATTCAGCGCGAAAAAGAGCGTGAGCTGCGGGAGCAGCGCGAAAAGGAGCAGCGGGAAAAAGAGCAACGGGAAAAGGA
        GCAACGTGAGCGAGAGCAACGTGAGAAGGAGCAGCGCGAGAAGGAGGCACGGGAACGAAAGCTGCGGGACGAGGAGCGTG
        AGCGCGAACGGGAGCGACAGCAATTGTTGACTGCCTCGCACCATTACTCGAATCAGTTGTACTCCCCACTGAACCGAAAT
        CTATTGGGTTCCATGATTCCACATCTGAATATGAGTTTACGAGGACCCCCAGGTGCACTTCATGGCCTTCCCGGAATGTC
        GCACTATCATGCAGCGGCGGCAAATGCCCAGCGGCAGAGTCCCCATGGAGCCATGGGTCTTAATCTTGGCATGGCTGGCC
        TCCCAGGCGTTCCCCCCCTCGGTGGTCACGGGCCTAATCTGCAGCACCACCTGCAGCAGGCGGCCATGGGCTTGGCTCAT
        CCGGGAGCCGCTGGCCTCACGCATCCCGGCTTCTCAGCCGCTGCCCTTGGACTCGGCGCGCATCCGCACAGTCTGAACCT
        CAGCCATCCGCATATGTCGCCACACCATCCCGCCTCCCTGGCTCACCAATTGCCACCGCATACCTCTTCGGCCGGCGGAG
        GGGGGCTAAGCAACTCCATACCCGTCACAGCTAGCTCCAGTTTGTCTGCGTCCTCACCACACACCAGCCTAAATCTGACA
        TCATCTGTAAAGCTAAGCGCGGATCAGGTACCCACATCGACGCCCAGCGGTGGTGTCAGCGGCAGTGGAATGCCTCCGAC
        TACCTCTAGTTCCCACATTCCCAACATGGGTCACTATTACCACCACGGGCATTTGGCGGCCATGCATGCGGCTGCAGCGG
        CGGCAAGCGGAATGACTCCGACCGCTGCCCATCAACAGCAGCCCCTGTCGCTGCCCAGCTCACCCAAAATCACGCCACCG
        ATCACTCCATCTTCCTCGGCCAACGGAGGCAGAGCGGGCGGCAGTCCACATGCCATGAGGCATCATATTGCGGCAGCGGT
        GGCTGCTGCAGCCCAACAATCGGCGATGATCGACAAGGCAGCCACGCCGGTGACCCATGAGCCCACCACCTTGGATTTAA
        CCGGGTCAAATTCAAATTCGAGCAACCAGGCGCCATCTAACGCAAGCAGTGGCCAGCCGACAAACCACGAAGTGAATGGA
        GCTGAATCCAATGGAGCGTCGCAGACAGAAAGCAAGGAGCACTTGGCAATCAAAGAGGATGGCCACAAAAGTTCTCCGCC
        GCCGGTGGCGCTTGAAAAGAAGCCAGCCACGCCGAATGCAGCTGCAGACAAACCCATCCATCCGGACAGCTCCCCGGAAA
        ACTCTTCCCGGCGCAGTGCCAGTCCCCAATCGGACGCGAACAACTCGCTGCCGGCGGTCAGTGTTACCGCAGCAGCATCA
        GGTAAATGCAAAGAGGAGACCCCAAAGATTCTAGACTCGGACACGACTGCCACAACAAAGACAGACATAGAGGAGGAGAA
        ACAGCGGGCCAGGCTATCGGTATCGCCGACACCGACTGCACCAAAGATCATGGTCGCCTCACCAGACACAGTGTCTACCT
        CGGGCGGGGTGACTTCCACAACCAGTGGCACCACCCCGCCACCGGTGGTCAGCAGCAGCACCAGCAGTGCAGGCAAGGCG
        CCGGCCCTGACCAGCGACGAGGTGTCCACCAGTGCCGCCACGTCCGCTGCCGAGCCCACCAGATGATGAATGGTCCCCTG
        GCGGGAGTGGGTCGATTAGTGAAGCGTATGTTCGCTTAAGTTTAAGTTTTGAAAGTCGCATCGGATCGGAACTAGTTAAC
        ATCTACCTTCAGTAACATTATACTAAGCGATAATTTAGTTGTTAGTCGAGCCTCTTAATTTATACAAGAAATTGTAATGT
        ATTGCCAGCGCCGCTTAGATCCAATTCTAAACGTTATAATCCTTAGTTATCATTATTATTTCCCTATTTAATGTGAAGCG
        TATACTTTTAGAAATGGCCTGAATAAATAATTTTTGTTTACAATT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0071838
        6842
        FBtr0112820
        5214
        FBtr0331942
        8360
        FBtr0479815
        8340
        FBtr0479816
        8340
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0304274
        944
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0071749
        1995
        FBpp0111732
        1535
        FBpp0304275
        1916
        FBpp0428148
        1926
        FBpp0428149
        1959
        Comments

        Transcriptional initiation site supported by short-capped RNA data (FBrf0209722).

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        px-RD
        Secondary FlyBase IDs
          References (0)