Open Close
General Information
Symbol
Dmel\CG31760-RC
Species
D. melanogaster
Annotation Symbol
CG31760-RC
FlyBase ID
FBtr0331996
Feature type
Associated gene
Evidence Rank
Length (nt)
4411
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 16 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GGACAGTTCGTCGCGGAGTTTCGAGTGTGTCGGTTGTGCCATAGCGGAATAACGGTACAACAAAGCCAGTGTGTGTAAGA
        AAGCAGCTACAAACAAAATTGAATAAAACCAAACAATAAAAGAAACGTTAAAGTGGAGGGAGATGATGAAGTGAAAATAA
        CAGGCTCAGTGATAACTGATACAAAAGGAAAAACGCTTGAAAATCAGACGTCTTTGATTTTGCAGAAGGCAATAGAAAGT
        GCGAGTCATGATTTGATTTTCAGGAAAAAGGAGTTGCAAATGCGAAAACAACAATGAAATGCTGGCACAATGTGGTGAGG
        CGCAGAAGGAAGAAGCCGACGGCAGCGGCGGCGGCGAAAGGATCAAAGGGGTCGCATGGAGGCGTGGCAAGTCCTCGAGA
        TGAAGATGCCATCTGCCAGCGGCAGCAACAAGTGGATACCTACACTTGGCTAACAACACAAGCTGTCCCTCTGCTGTGGC
        TGCACTTGTTGCTCCTTGTCGCATTTGCAAAACATGCGGCTGCAGCCACAACAATTGCCACAAATCCCGAGGCCACCACA
        ACAACGGTGAGCAACTACACGGTGACGACCACGGCACTATCATCATCCACGACAACCACTTCATCGGGATCAGCTCCAGC
        TTTATCATCTGCGGCGGATAAGTTCGCCGGCAACTGGGCCAACTTGGAGGATTCGTTCCGGAATATCGTGCGGATTGGTG
        ATGGGAACACGGTGACACGGACGTCCATTGAACAATCGCTGGTGACGATACACGACATTGCCACCGAGAACTTGGGGACA
        TTGTGCATCTCGACCCTATATCGCCCCCTACAAGTGCCCATCAACTCGGAACGATATGAGAGCTCTAGACAGAAAACCGA
        TTTGGCCGCCTCGATACTCCAGGAAGTGGGCATCATTCGGCACGGCGGACTGTCGGATGCTTTAGCCAAAGGCCTGCTAA
        CCGATGACTTTATAACTGGAGCCCGCATTTTGGCCCTGAATCTAACGAATGGAGCGGTCCAGTCCTACGTCTGGTGGGTC
        AAGGGAACAGCGGCGGAAATCCAGCGGTACGACGAGGACGGACTGCAGATTGGCAAAAAGCCCGCTGGCAGTTATCCCTG
        GTTCGACGATGAAACATCCTCACCCACCTTGCGTTCGCCCAAATTCGCGCCCAGTCCGCCCAACAACTACTACAAGGGCT
        GGTGGACATATCCCTACTTCTCGTGCTCGCAGAGCCGCTGGCTGGTGTCCTACAGCATTGCCATTCCGCCGATTGGGCGC
        CATGGGTTAAGGGGCTTCATCAGCATCGACATTGATGTGTCCACGCTGCGGGTTAACCAATGCGAGGCGGAGCCCTATCC
        ATTTGGCAGTCGCCGGCAGAAAATGCAGCAACTGCAGACGCACAATCGTTTGGGGGCACGAAGATCCTTGTTTTTGGGCA
        GCCGAATGGGGGCCATCGATGAGAGCACCATCAACGATTTGCAGGCATTCCACAGCTCCCACAAGTGTCATCGCACCTCA
        ATGGTGTGTGATTACCGTCAGCCAAGTGCGGAGACTCCTACCGTAACTGGTGGCAAATTGCTGACCACGCTGACCGGAAG
        CAGCAGCTGGACTCGTGGATCGTACCAGTGCCTCTGCCGCGGGGGATTCTACTCGCTGCGGCATCCGGACGGATTCAACG
        GCACCATCATGGAGATTGCCTGGCAGGAGCAGCAGGACAACATAAGCAATTACTATTCCGAGGTTTTTAAGTGTTTGCCC
        TGCGCCCCCGGCTGCGACACGTGCACGGGTCCGGAGCCATGTTTGGCCAACTACCACTGGCCATTCAGAATATCCCTGTT
        GACCATATCCATTGGCTGTGCCTGCGGCACCTTCGTTCTCGCCGGCTATCTCTTTCGGCATCGTCGCGTGAAGGTCTTCA
        AGGTGGCCAGCCCCATCTTTCTGATGATCACGCTCATCGGCTGCGCCATCATGTATCTGGAGATGGTAGCTATCTTTCCC
        TATCTGGATACCACTTGGTGTATTGCCACTAAATGGACGCGGCATATGGGTTTTTGCATCACCTACACTTCGCTGCTTAT
        GAAAACCTGGCGGGTTTCTTTAACGTATCGTGTCAAGTCGGCCCACAAAATAAAACTGAATGATCAGCAGCTTTTGCAGT
        GGATGGTGCCCATTCTGTTGGTTATGTTGATCTACTTGGGCACATGGACGATTTCGGCAACGCCCACAGCAGAAGTGATC
        TTAGATCAGAGTCAGTTGAAGTTCAAGCAGTGCTCGTACAACTGGTGGGATCACAGTTTGGCCATCGGAGAAGTGTTCTT
        CCTGGCCTGGGGCATCCGGGTTTGCTACAATGTGCGAAATGCGGAGAGTCTGTACAACGAGGCCCGGCTCATCTCCTACG
        CCATCTACAACATAGCCCTCGTCAATATCGCCATGGTGGTGTTCCATGTAATGCTCTTTCCGAACGCCGGACCCGATTAT
        AAGTATATGCTGGGATTTGTGCGCACCCAGCTTTCCACGACCACCACCATTGCCCTCGTCTTCGGTCCAAAGATTTTGCG
        TGTCTTTAAGGGCCAAGGCGACAAGTGGGATCAGAAGGCCAAGGTGCGGAGCATAACAGCATCATTCTCGCTAAATGGAG
        TGGGTCTGGTCCCGGAGGAGTCGCCTGATCTTTACCAGGAGAACGAAGAACTCAAGGAACAAGTCCAGAAACTGGCCCAC
        CAAATCGAGTTCATGAAGACTGTGCACATGCAGATGAACAACAGGCATCTGAAGCCAAAGCCCGGCGGATATTTTACCAT
        AACTTCAACCTCGTTTCAAGCGCCATATAGCAAAAACACGGTTTCCACAGCGCAGACGCAAACGGGCAAGGATGAGAACA
        GCACGCCAACGAAATTAAAATCGCCCAAAGGCAAAGTCTGACGAGGTCAACGAAGTGTTAAAGATTGCTCAATAGAAATC
        GATGGGGGGCAGGGCAGAACCACCCTGGTGGAGGATGCCATTGAATTTAATTTCCACCTAGCGGATACGGAGAAGGGGTT
        GATTGTCCAGGAAGACGAGCGGCCAGGATCAGATGAGGAGGAGGCGGCCTTGATCGCACAGTTTCGCCGCCTCTTTGCGC
        CCATTTTGGATGATAGCTTGAATCTGTACTACCAACTCAACGATTTGGATGACACGGAGCACGTGAGGATCCATCAAACG
        GTAGCCCAGATGAATGATCTGACCAGCAGCGAAGAGGAGACAATGGTTACCCAGGTGAACAGTCCATCGCCACCGCCGGT
        GGGTGTGGAACTTTTGCTTCCAATCTCCAGCGACAGTTCGACGGCCAGCAGTTCTCTGTACGCCATCCACACTCCGTCTC
        CGGCTCATCCCAGTGGTGTGCTCCTGATGCCCCAGAATTTGGAGTCACCGTTGCTGTCCGGCAGTGATGCCATCACAATC
        ACCGAGCAGGTAGAGCTGCATAATCCGCCACACCATCTGCAGCTACTCGAGGATGAGAACAACACATCCTGTTCGCTGTC
        ATCGAATCTGACGGATAGCAAGACCCTGGATGGTCGCACCCCAATCGTCGTCTGATGGCTTCCATCTCCAATCCCGTTCT
        GCTTAACTTGTGATTATGTTTACACAGTCTTAGAGCTACAACAAACAGTTAGCGAAAAATAAGCCGCTTAATGTTTAATA
        TAGTCTTAAATAATGTTTGTGTGTATGTGTCTGTCAAAGTTGTTTAAATATTAAAGGCGTTTATGCGGTAAGTCAAATCA
        TTTCGAACATCATTTCATTGCTTAAACTATTTCAAATGAAGCTTCCAATATTTATAGAAACCCAGAAATTTTAGCAAATA
        TCCCACCAAATACATTTTTCAAATTTCTTAGAACTTTTACTTATTTTCTCAAATGAAACAATGATATATACATTTCTAAA
        ATATCTTTTCACAAAACTATTTTATTTGTCGAACGCCTGTCTTAATTCACAATTCGAACATTGCCTCTTTTCACTTTTAA
        GAACGTTTCATCCTTAAACTTAAACTTTCCAGCCGCATAAACGCAAACTTCATGTGTAACCTTTTATTTTCGCTTTTTAG
        TCATATCCACCCAAATCATTATCCCATCATCCATGATCTCCATCGTTTTTGAAACAGCAGAAAAGTATCAACATTGAGCA
        AATTTTTCTCACTTCGTTCGGATCGACAGAAGGATGTTGTATAGAAGAAAGTAGGCAGCCAGTTGGTCTGATGGGTCTCA
        TAGAGTCCATCGGAGCCCCTAGGGACTTGGCATTAATAAATCTCATTTAGCACTCATGCACCTAGCGAAATAAATTGCAT
        TTTCCTTGTTCTCGTTGCACCCATTCATAGGACAAATATTATTTGCTTCGTAGCTAAATTTACATGATTTTCATGGTCAT
        AATCTTAAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0301019
        4389
        FBtr0331997
        4647
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0304318
        1093
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0290241
        875
        FBpp0304319
        875
        Comments
        Stop-codon suppression (UGA) postulated (FlyBase analysis); reflected in aa sequence of predicted polypeptide.
        Transcript terminates at site supported by polyadenylated cDNA.
        translation_exception: stop_codon_readthrough
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG31760-RC
        Secondary FlyBase IDs
          References (0)