Open Close
General Information
Symbol
Dmel\Wbp2-RF
Species
D. melanogaster
Annotation Symbol
CG11009-RF
FlyBase ID
FBtr0332047
Feature type
Associated gene
Evidence Rank
Length (nt)
1242
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 68 )
Sequence
TTTTCACTATGAATCATCAGCTGTCGTCAGTTTTCTAGAAAAACAAAACGTAGTTGTATGAAATTTTTGCAAATTTTTGT
GGACTCAAAACAGTTGGAAAATTAAAGAGACATGTCGGTTAATACGGCTCACGCCAACAATGGCGTGCTCATCCATGCTG
GAGAGTACATACTGCTCCACAGCGACAGTGTCTCCATGGAGTTCTCCGGTCAGGACAATCCCATCTTCAAGGGCTCCAAA
GGTGGCAGGATTTATCTCACCTCCCACCGAATGATCTTCAATAGCAAGAAGTCCTCGGATTCGATGCAGTCGTTCAGTGC
CCCGTTTGTTGCTCTTTCGGATGTGGAAATCGAACAGCCCGTTTTCGGGGCCAACTACATCAAGGGAAAGGTTCGCGCTC
AGCCAAATGGAAACTACGTGGGCGAGGTCAAGTTCAAGCTCCATTTCAAGGCAGGCGGCGCAATTGAATATGGTCAAGCT
CTACTGCGCTCCGCCAAGACGGCGATGAACAACTACCACCGCGGTGGTCTGGCTGGTGATGATCCGCCACCATATCAGCC
GGCTGGATCCTGGAATGAGGCACCACCGCCGGCATATCAGCCACCACCTGGCTACTATGGCTGGCTGCCGCAGCATGACG
CATTCAGCGGCCCTGCGCCGAATACGGTCTATATGAGCGACAATCCGCCGCCGTATCCGGGTATCGTGTAATTAAAAGCA
AACTACTGTACCTCAAATAGCCATCCCGACAAATTCCAAAGAAGCCGAAGCTGCAGCAAGTGCTTACAACACACCCTACA
ACCAAGGCGGGCCCAGTGGATCAGGCAACAATGATTTACCACCTTCTTATAATAACTTGCCACCCAGTTATGATGATGCA
TCGAAAAAAAATCACTAAAAGAAGCTGCATACTATATTCCCTTACGAAGAAATGCTAAATAACTAAGTAATTACTGCTCA
TTCCGTTGATGAAACTCTACACGAAATTATTGTTGTTTTCGGGCATTACAAATGTGCTTGGTTGGAATATTTGCTTGGAA
TTGTTGCTAATTAAATTCTTTCATAAGCAGCATATTCTTCATATGCTTTGATTTCTGGTCACAAAATTAGAATTTTGCTC
TTTCGGCTTGATAAATTGTATTATTTTATATATGAACATAACATTAACCAACTTGTTGTTATATGAGAAAAACAGTACTA
TTTTATCCGTTATAATATATAAACAATTTATTATATAAAAGT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0273240
1758
FBtr0273241
1751
FBtr0332045
1291
FBtr0332046
1610
FBtr0332048
1369
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0304357
199
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0271748
337
FBpp0271749
337
FBpp0304355
226
FBpp0304356
384
FBpp0304358
342
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Wbp2-RF
Secondary FlyBase IDs
    References (0)