Open Close
General Information
Symbol
Dmel\CG6610-RC
Species
D. melanogaster
Annotation Symbol
CG6610-RC
FlyBase ID
FBtr0332060
Feature type
Associated gene
Evidence Rank
Length (nt)
520
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 76 )
Sequence
CCAGTTTTTGCGCAGAATTCCGCATTGTTTACCTCGCTGCTAAAAAGTTTTTAGCGCAATTCCAATTATTATTGTTAATA
ATAGTAAACAAATCATACGACAACATGACTGCCGTTCCACCCCCCTCCAACATCTCTACCCTAATGCCATTGGAATTGGT
GGACAAATGCATCGGTTCCCGCATCCACATTATCATGAAGAACGACAAGGAGATGGTGGGAACTCTCTTAGGATTCGATG
ACTTTGTGAATATGCTCTTGGACGACGTAACGGAGTATGAAAATACCCCCGACGGCCGCCGCATCACCAAACTGGATCAG
ATTCTGCTCAACGGGAACAATATCACAATGTTGGTGCCTGGCGGAGAGCTGGCGGAGTAGCAAGGTTCCATTTGTAAACA
TAAATACATTTGTAAAATATCAAAACGGTCGTTTTAATGTGGATAATATTGTGTCGTATGTAAATGTTCGAGATACGAAT
TTGAAAACGCTTGGCTTAGGAAATGAAAATTATTTGCCCT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0077048
586
FBtr0332059
421
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0304370
91
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0076756
91
FBpp0304369
91
Comments

Extended 3' UTR based on RNA-Seq and/or EST data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CG6610-RC
Secondary FlyBase IDs
    References (0)