Open Close
General Information
Symbol
Dmel\CG9525-RB
Species
D. melanogaster
Annotation Symbol
CG9525-RB
FlyBase ID
FBtr0332188
Feature type
Associated gene
Evidence Rank
Length (nt)
3043
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            ATGAAAACTTCGAAGACGCTGATTTTCATTATAGCCATATTTCTAATAAGCCATTTGTCTCTGAGTAAGAAGAGAAACTC
            GCAATTTAATCAAGTCCAGCATGAGCACTATATCAAGACATCAGAGTGCCATATACCATATATCAATAAACCATTGGAAA
            ATGAAAAAGGAAACATAAAAAAACAACACACAATTTGTTCCAAAGATGAAAGTTTGATAAACCTTCGTTTCGACGAGAAA
            TCCCATCAATATTTATTGTATGTAAATGATCATGTGGCCCAGCTAAAACTAAGATCTATGAAAAAGAAATCTCCCAACCT
            GATTGGATACAATTGCAGTTATCGTGAGCTCAAAAGGTTAAATCGCGACTATATCGTTGATGCACCTGTTGTCCTTGGCG
            AGGAAGTTAAATTTTGGAATGGCTATATTGTTCCCCCTTCTGTGGAGGGGATGCGTGCAACTTGCCGAAATGAACTGGCA
            GAGGATCTACAATCAGATACTTTTGTCTTAGTGCAACCTCCTAAGACATATGCACCACTTATTTCTTGGCACCGCATACC
            GAATGTTTTATTGATTGGATTCGATGGCATTTCCCAGATCAACTTTCGTCGCAACTTTCCCCTTGTATTCAATCAATTAA
            AAATGCAGGACTGGTTCAGAATGGACGGATACACAGGAATTGGTGAGAACACCCAGTCCAATTTAATGGCTTCACTGACT
            GGCTACAGTCCTCACACTTTGATGAATCTCAAATGCGATTCGAGTGTGATTGGTTGCCTTAAAACTGTTCCGCTGATATG
            GAAGCATTTCAAAAAGAAGGGTTTTATAACAGCCTATGGCGAGGGAATTTCCAATTTGTTTGATTCGGAAAAGTATGGGA
            TTTTTGAAGGTACCATTGACTTTTATGCTCGTCATAAGAATCTTCAAAGTTGCATTGATAGGCGATTTAATATCAAGCAT
            AACTACGACTATTGTGAGGAATTTTTAAAACGACATGCTAACACCAACCGTCCTTTTTTCGGGGTTTTCTTTGGAAACGG
            AATAACCAATAGATCTTATGATAATGCCAGAATACAAACTGAACTGTTGGATAAAGTAAAGAAATTCAAGAAAATGGGTA
            TTCTCACTCAGTCAATTGTCGTCCTATTCAGCTATCCTGTGTCATCCGTAAAAGAAAAGAAAACGAACTTTTCTCAAGAA
            GATTTACCAATTTTGTATATTTGGCTACCACCTTGGTTTAAAGCATTCCGTCCTGAAATAGTTCAAGCATTAAGGATCAA
            TAGTAAACGTTTGACTTCACCATACGATCTTCATCTTACACTGCAACACCTCTTGGAACTGGGAGAACGTTGGCCTCGAG
            CGGTGGACAAGCTGGTGGATTGCCCCACTTGTCAAACCCTTTTTGCTCCTGTTCCCGAAAATCGAACCTGTTCAGATGCT
            GGCATAGGAGAATCCCAATGTCCATGTGATAGCTACAAGCTGCTTAGCTCCAATCAGATGAAACAATTGTCTGTGGGAAA
            GCAAATTGTGCGCAGTATAAATGAATTCCTTAACCATCACAACTTGCATGAGTTGTGCCATAATCTTACACTGAAATCAG
            TCAAAATGGTGTTGCAACGAAAGGATAGAAAATTATCTAGTGGCAGCACCTATAGAGCATATTTCAGTGCCAACCCAAAT
            AATGCAGAATTTTCCACAACTATCCGCTACGCTAATAATCGCCAAGAACTGGAATATATAAATGTGGAGTCCATAAACCG
            ATTGAATAACTATCAAAATGACTCGAGTTGCATGCGAAGATTGCGAGGCAGAAAGTTTTGTATATGCAAGAGCCAAATAC
            TAGAAAATCACAGCACTTCAGAGGTCACAAAATTAATACCGAATAAAAATAAAATAGATGATAAATTATATGAATTACCA
            GACATGCGAGAAAACGACCAAAACATTGAAACATTGAACATTGAAGTTATTTCGGTGTAACTAATGATAAATTTAGTTAT
            CTAACTATATACTTTTGGGTTATAATCCAAGTGATTTGAACAATATAAGCTTAAAGCACTAGGTGCCATCCATATATCAA
            CATTATTAAAACCAGGGTTATCTCAATTTTACCTTCTCAGGTAAACCTTGCTAAAAGCAATCACAGATAGTGACACAATC
            AGACCCATAAGTTACTGAGTTATCCATTTTACCATTATCCGGACAGCTCCCAGTCACTCTTGTTCTCGACTGGAATGGGA
            CAATTTCATTGTTTAAAAATTTAATTGTTATCTACTTCAGCGTGCATACGTATGTACAAGCCAATGCACAATATTCACAA
            TATGTTTCTACTTTGACTTATATACAATACATTGACCTATAAAATGAGAATAATTTCTTAAATCTACAACCAATGTAACA
            CCTAGAAGCAAATAATGTCAAACCCATATTGAATTCAGCCTGCATTTACGTTGCAAAACTTTCCACCCTTACAATAAAAT
            AATTGACAGTAGATAAGATTAACAGTGCTGTAAATCCCTAATTTATTTGATATCTAGAACTCTCAAGTCGCTTATACTAA
            GCGGGATGCGTCAAGAAATAATTTTATCTTTGTTTGCATGTAGGTGAAAAATGACAGGTGTCACACAACACTGAAGAACT
            TTGTCGTCGGACCCCGGAAAATAAATCTTATATCTTATATCTTTATACAATGCTATTAGCTATGCCATTAGTTTGCAAAG
            CGGAAATGAAAGCACTTATCTAATTCTTGGGACTGCGGAAGTTGTGTTGGGTCCCATATTATATATCCAATCAATATGTC
            GAATCGTCAGATAAATTGATACTTGTGCCCAGGTTGAAAGCCAGAACTTCTGCCTCATGATTGGCCGCTTATCATTTGAA
            AGGCTATGTTTTGTCTACTTATTAACATTGTTTACTAATTCATTATGATAATGGGCCGTCGGCGACTATCAGTATCAGTT
            CAGATGAGGACAGGCACTCCCGAGGCACAGTGGCGTAATTTAAAGTTTTCACTATTATATTTATATAAATTATATTGCAG
            TTT
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0079786
            2070
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0304497
            659
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0079386
            678
            Comments

            3' UTR based on RNA-Seq data.

            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (1)
            Reported As
            Symbol Synonym
            CG9525-RB
            Secondary FlyBase IDs
              References (0)