Open Close
General Information
Symbol
Dmel\CG10803-RE
Species
D. melanogaster
Annotation Symbol
CG10803-RE
FlyBase ID
FBtr0332285
Feature type
Associated gene
Evidence Rank
Length (nt)
4744
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 26 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATTGTTTTTATCGCGAATTGCCAACGCTCTGTACAAGTGATGTACAACACGAGTTAAATACAAAACAAAACGAACGGATA
          AAAGTTGCACGCTGGGCGAATCGTGACAAAGAGGGCGTGGCAAATCGAAATATAGTATAGATCAAATCCCCAGAAGGCGC
          GGCATAAACGTAATATGCGAAAATCGCTGCCATGAAAAAGGGCAAGGGATCAAGCTCCCTTGGATCGAAGGAATCATCGG
          GGAGACCATCCACGGCAGTCCTGGTGTTCAAGAAGTGCGCTAGATTTGCGGACTCTTCAGAATCGGCGGAGATCCAGCAG
          GACGGCAAGGAGCAACTGCCTGAGAGGCAAGACTCGCTGGATGCCAAGGAATCTGCAGGAATGGAAAAAGAGGCGATTAG
          CAATCAGCCATTAAAGGATGAGCCATCGAAAGATGAACCTAACCAAAGCGAGGGCACTGCCATTTCCACCATACCGGCGA
          TTGATAAACTACGTCGCTTCTGCTTTATTGGATCCACGGACGAGCCCGTCTATACCACGCCCGCACTGGATCTTGTTGTC
          GAGAACAATTTCGCATCGCTAAAGGAACTCTGCTCCCAAGTGAGTGAAGACGAGCTGGTCGAGTGCTTGTTGAGCGTTTT
          GGGCAGCGAACCAAATGAGGAGCAACCTCCCCGACCCGACGAGCCGCTCCTAATCCTGGCTGTTTTCTTTACCACGTGCG
          AAGACGAGAAGAAGCGAAATGCGGTGCGTAATAGATTCACCGACCTGATCACCAGCGAATCGGATCTTCTACTGTTCGTC
          CAGTTGGTCAAGCGAGTCCAGAAGTTGCTCGAACGTAAAACGCCCTTCAATCGCACAGTGCGAAAGGCCGTCCTCAACTG
          GTATGGCACGAAATCGCTTGATCGCCTTCTCCACTTCTGGTCAATAGGCGATGGAAATCGTTGGCCTGCGCATCGCGATC
          TACTGTACCGCCTCCATTTTCGGCATGCCAATTTTTTACCGGAAATCATTGCTGCCTTAAGGCTGCTCTCATCATCGCCA
          AAGGAGCTATCGCAGTGGCCTGATTTTTTAACGCCCTTGACCAGCTTTCGCGAAACTATTGAGGGTGTTGTGAAGCTTCG
          GCTACTCACGGATCCCGAACAGGCTATCTCCATTGTGAAGAAGTTGTCGCTGAGCTGGGAGCATGTGCCTTTTCATTTGC
          TTCACGACCCCAGGCTGGCGCATTTTCTTATTCCACACATGAGCTATGAGCAACTTCTTCAGAAATGGCCACGCCTCTCG
          CGACTTAACTCCCGAGTGCGCCCCTTTGCTGAGCAATTGCTGGATAAGAAGAAGCTTAAGGCGAGCAATGTTCCGCCCGT
          ACGTCTGCTGTTGGAGGATATGCGTTTGAGGAAGCCCAAAAAGTGTGCAACTACTTCGTTCCAAAAGGCGAGTTTCCTGC
          ATAGCGTCTACGAAATATCCTTTGGCCTGAACAAGGCACTCGGTAGGCGACTGCACATTACCCTCAATCTGGAGCAGGCC
          TATCTGGGCAAATACCTTTCTGGTCCATGTCGTTCGCTGAAGTACTTAGACGCCCTGGTGGCATTGGGTTTTGGCTATTT
          CCGCAGCGACCGAAAGGTGACGGTGGAGTTTTGGCACGACCGCAGTGGCAAATTGAAGGCGTTGCCGTGGACAAATGAGA
          TGTCTGTTTCAGAGGCCAAGACCTGTTGCGAGAATCAGAAGGTGGGCAAAGTGAGGCAATCGCTAAATGAAATTCTGTTC
          AGAGCGCTATTGGATATGCAGAATACGTTCGACGTGTTTTTGGTACTAGTGCCGGGTGCCGCGCGAGGAAATCCGGAAAA
          TAATTCAAAGTGCTTGGCTGCTCTAATGGATAAGTATCGCGAAAAGCGAAACTCTAATGCTAAATTCATAATGGTGAGCC
          TGCGGCAGCGTCAACGCTCCATGATATATTCCAGCGGACGAAACGAGAACTTGTTAGAGTTGTGCAGCCTGGATAAGCAC
          ACACCGCGTTTGATTAACGCATTTGTCCGCAATAAGTTCTACTAGACGGTGAGCTGCATTGCGAATATCGGACGACCCAT
          TTCATCGCACAACTGCAGGCACAAAGCAGTTCCATTTGTTGAAGGACGATGGCCATCGGTTAGTTGCCATCGGCCATCTC
          TCTCGCTTTCATAGATGCCTGGTCGTTCGGTCCTCTCACTCCATTTTCGAATAGCTTTTGTGTAACATATTCATAGGCCC
          TTGGTGTGTAATCGTTGTAGAACCAGGCCACCAACTCAATGCTACATTCATATTTACATACTACTAATTGTAATAGTTGC
          ATCCCGGAATCCAGAATTTAAAATTCCTATCGGGCTAGTAAGATATTATCGCTCGTTTTGTGTAATGAAATTGTGTATTA
          GCATTTGTAATTTTTACTCGATTTGGTGTATTCATTTTGTTAAAATTAAACCGAATCAACTGAACTGAACTTAATCTAAA
          TTCAATTTGGATTTAAAACAATCTCAATGAAATCGCAAGCGCAAACAACAACAAAAGAACCGACAAAAAAAAAAAAAAAG
          AAAAACAAATTGCCTTACAAACAAAAATGTTAGTAAAACTTTCATTTTAGTTTAGACTTTTTCAAAAATTGAATACTGGA
          ACTGAAACACAATTTATGGCATTTAGATAAAGTTAAAGTTAAATATAAACTAATTGTATGGCCTATGTATTGAATATTAA
          TCTAACGTAACATTAAAATAGTCCAAGTCAAAGCAATAATCACCAATCACTAAAGCAAATCCAGTTATAGCCTCAGATCT
          TTTATAGATTTTTGTTGTGCTCGAATAGAATCGAATTAAATTAGCTAAATAGTTGAAACGCGTACAAGGCAAAAATTAAT
          GGTAAACAAAAACTCCCAATGTGCCATACACAACCCACAGCCCACAAAACAAACACATTCACCCCAAACTCTTGATCAGT
          ATACATATTTATTAGGTTTGTGTGCAAAATTGCCGAACCGAAACCAAATAGAGAACAATAACGAAACGACGAGCAAACGC
          TACCAATTTGACTAAAATTAGTTAAGTGAAATTATACTCAAATTACGATTAAATTACATTTACTTGTATAGAAAGCAAAG
          CAACCAATTTGGATGATAAGCAAAAGCCAACTGAAAATAGGAAAATTGAAATCGAAAATTAACTAAACAGAAATCGAAAG
          GACAAAAACAAAAACAAAAAAAACAAAAACAAAACAAAATAGGAAATATTTCCACGGACATTTCTAACCAAATGTTTCCA
          CACGCGTCTGTGAAGTAAACCGTTGTGATCGCTTTAGATTTTGATTTAACAAACAAACAAAAACATTAAATACAAAACTA
          CAAACTACTAAATACTGAATACTGAATACAAAAACAGATAAGCCGGAAAATGAGCCGCAACAGGCAGCTATAAGTTATTT
          TATATATTTTGTAAACTCGAAATCATTAGGAGTGTAACCGAAAAGTACCTATACAACAAAAGCTAAACTTAAAATGAAAC
          TGATACTGCAGAGCCAACCAATTGAACTCCAAAAAAAAAAACCCAACAGAATTACGGATAATATATCCACAACTGCCCGA
          GGGAAATCCAGAATAAGATTGTCGGTAGAAAGAAGATAGGATCCATGGACTACCGCAGAATGTATGCACTTTACAGATTT
          TGAATTTATTGTTACTAATGTTAAGTTCTTTATAAAGAATTTTGACCCTAAGAATTATTTGAAGGCACGCAACAGAATAG
          CACAGTGAAATGAGTAAGGATTCGAATGTATTTGTTCCTCGCTTATTATTTATTTTACATTCATTTTAGTTTATAACTCG
          AGAATTTTACTATCGGTCTATTAGCCAATTAAGAAAAATCCCGACACATATATTTTTACGCATTCCAAATTTGAAAAATT
          GTCTTGCTTTCTCTTTTTTTTGTATTATTAGATTATTATGTATTGTATTGTATTATGTTATTGTTACTAAAAAAAAAAGT
          TACAAATTCAGTTTGTAAAGTGTAGTTCACCCAAACAACAGTAAAGTTAAGTCCGAAAAAGTTGAAGCACTGAAAAAGTA
          AAACAAAAAACTGAAGCCAAGGAAACACATTTCAGTTAGTGAAAATTTTAATAATGAAAATTATTGTTGTTGATCAAATC
          AAATCAATTTAAAGGAAACTGAAAAAAAAAAAAATAAAACCAAAACTGTAACTGAAATCGACTCGAAACGAATTGAATTA
          AATCCGCAGTAAAACAGCAACAAGAAGCAAAACATCATGTGATATCTATTTCAAAAATAAATCGATCGACAAACTAAAGA
          GATGACCTTACCATACAGAAGCCAGAATATAGTAAAATTAGCCTAAAGCCACGAAGCGTTCAGAAAACGGAGTTTCGAAG
          ACGAAATCGATTTTTTTTTTTTTAGTTTTTTTTTAGTTTTTCGTTGAAGAGTTACGTAAGATCCCGATCCACAGATCCAT
          TGAGTAAAAACCACAATCATCAGTAATATACGGCTCGACTTTGACTCTCTCTTTCTCGCCCCCTGAACCCGCACTATCTA
          TATATATCTCTTTCTGTCTTTAGTGTTAGTCGAAATTCGGATTGTACGCGCATTTCCAAAATGTTCAACTCCTTGCTAAA
          GTATTCCAAATGGTTTTTTATAAGCATATACATAAACGTATACATACTTCTTATACACTACCCTAGGCTAACGTTGAATA
          AATTCTGAATGATTCGAACAGCAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0070569
          2794
          FBtr0331610
          2896
          FBtr0331611
          2890
          FBtr0331612
          4798
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0304564
          617
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0070544
          637
          FBpp0304000
          574
          FBpp0304001
          574
          FBpp0304002
          574
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG10803-RE
          Secondary FlyBase IDs
            References (0)