Open Close
General Information
Symbol
Dmel\CG12773-RB
Species
D. melanogaster
Annotation Symbol
CG12773-RB
FlyBase ID
FBtr0332287
Feature type
Associated gene
Evidence Rank
Length (nt)
3620
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CTATCGTCTAACGCATATCGCAGCCCACCGAAAAGTCATCGATGACGACTTCTTGTAGTTTACCAATAAGCAAGTGTTTT
          TATTTAGCTTTTTGAGCGTTTATTGAGTGCGGTTACAGTTACTCAAGTGCGACCAAGACGATGCCCGCCGTTTCCCGCTT
          CGGTCGCCAGTGACTCGAATCCAGCGCCTGCAGCACCTCCATCGGATCTGCGATCTTCAGAGGATTCTCCACTGGCTGCC
          TGCGTGGATGTGCTCGCACTTGGACGTTTGGATGTTTGGGTGTAGCAGTGGGAGCGCAACGCCAAGAAATAGCAATCAGT
          TAATTGCCGCGATTACGCCCGAGTAGTCGTCAGATAACCCGCGAGAACAGCACAACGCAAAAACTGCTCAACTCCACGGG
          AGCAGCAGCAACAACAAGGCCAGCAAACAACTGCCAAAAGCGGTACGGGAAAAGCGGGGTGGAGCGGAGTGTGCGGTGCG
          AAGCGGAGCGGAGATGACTAATAGCTCTGAGGGCAATGGCAACGGCGGCCGACGCACTGTCGACTGGCAGAGATTTGGAC
          TTGGCGGCGACGAGGACGGGGATGTGGCGGTGACCAGCTTTCGCCAGCGGACCAACAACAACACCGGCGGATTTGTGGAT
          TTAGGTAACGAGTACACGTACGCGGCTGGTGGCCACCATGCGTCCGGGGCCAACGAGATCTTTGCGGGCGAGCAGGGCGA
          CAAGCCGTGGCGCTCGAACTTCTTCATCTCCCAGCCCGTGCTATTCGGCACCTGGGACGGAGTGTTCACCTCCTGCCTAA
          TCAACGTGTTTGGAGTGATCGTGTTCCTGCGATCCGGATGGATCGTCGCACAGGCAGGCATTCTGAACGCGGTGCTGATC
          ATCTTTTGCACGGTGGTCATAGCTCTCGTCAGCGTCCTCTCGGCAATCGGTATCTGCGAGCGGTGCCGTGTGGAAAGCGG
          TGGCGTGTACTTTCTCATAGCCCACACGCTTGGTTCCCGATTCGGAGGCGCCTTGGGTTTGCTCTACTGCTTTGGCCAGG
          CGGTGGGATGCGCCCTTAACGTAATGGGATTTGGCGAATCAATGGCTGGACTAGTGGGACTCGAGGGCAGCAAGTGGGCC
          ATCCGCGGGTTCGCTACGGCAGCGGTGCTCCTGTTGGGCTGCATCAACGTGGCCGGCGTCAAGTGGGTCATCAAGCTTCA
          GTTTATACTGCTCATGATACTGCTGATCTCGGCGCTGGACTTCATGGTGGGCAGCTTCACTAGTGAGGCCAGTGGCGGCT
          TTAATGGCTGGGCGAGCGGAAACTTCGTGGAGAACCTATGGCCAAAGTACGACGACGGCTACTCCTGGTTCCGTGTGTTC
          GGCGTCTTCTTTCCCACCGTCACCGGAGTGCTGTCGGGCATTAACATGAGCGGCGACTTGCGCGCGCCGTCCACGGACAT
          TCCCAATGGCACCCTGGCCGCCTTTGGCACCTCCACGTTCCTGTACTTGGTGTTCGTCCTGTTTTTGGGGGCCACCTGCC
          AACGAAGCTTCCTGTATACTGACTACATGATCTCTGTCAAGGTGTCTGCCGTGCATTTCCTGCTGTTGGCCGGCATTTAT
          GTGTCCAGCATGTCCTCCTGCCTGGGCGCCATGTACGGCACTCCGCGCGTCCTTCAGAGCATCGCCAAAGAGAGCGTCAT
          TCCGGGCATCGATATCCTGGGAAAGGGTCGTGGTCCCAACAAAGTGCCTTTATACGCAATGGCCATCGTGGCCCTAGTCA
          CTGTCACCTTCATTATCGTGGGAGACATCAACTTCTTGGCGCCGATCGTGACCATGCCCTTCCTGCTCACATATGCCTGT
          ATCGACTACGCCTACTTTGCGCTGGCCCAGACCTTCGACATTCAGGAGCAGCGCGAGGAGCGTTTCCGCATCCAGGCGTC
          GAGTCCCAGCTACGAGACGCGCCGTTACGGCAGTGTTTCGGACACGGGCAACGACCTGGACCTCCTGTTCCCTGATCGGG
          TGCGCCACAAGAACCTGCAGAGTCCGCAGAACTCACCGCTGCACCAAACAGTGCCCCTGGAGTTTGACAACGAGGGTCCC
          AGCACCTCCAACCAGGCCCAGTCTTCGGAACGGAGAACGGGGCACGAGGCGGACACCACACTGGCCGTGGAGCAGGCAGT
          CGCGCAGGCCGGCGTCGAACAGGACCAGGGCGACGAGGCCGAACCGATAGCCCCGATCCGTCCGCCCATCCACTCCAAGA
          CGAAAAACTGGTACTCCGGCTACTGTAATCGCTGGGCCTCTCTGCTGGGGGCCTTCACTAAACTGCTGGTTATGCTGCTA
          GTCAACTGGTACTACGCCCTCACCTGCTTCTTGGTGGTGTTCGTCGTATGGTTCTATGTGGGCACAGCCAATCCGGCCGT
          GAAGCCGGGTCTCACTGCGGAGTTTAACTTCTTCGCCTGGCTGAAGAGCGTCATATTCCGGTGCTTCGGCAAACGGATGA
          ACGAGTACGAGCAGATAGTCGTGACACCCTCGTGCCCAGGCGTTGATCTCTCACCCACGCAGCTCAACGAGCAGAACGAG
          GACTTCCGTCCGCGGCCCAACTACCACCACTCGTCCGTTATCGAGGGTCGCCTCATAGATGACATCTAGACCGAGTCCAG
          GGTCTAGAGCACAGGTTCACCTGTATGCGGGCCGGGCAACGGGGCAGGCGGCGTGGCTGTGGAAAGCAATAGTCGAGTGC
          ATTTCTCTACCGCTAAGCAGTACTACGTTTAACTAAAGTGAAGTAGAGCCGGCGAGGCAGCCGAACTAAACTTAACCCTA
          TGTGTGTTTGTAAATCTGTACGAATGTATTTGATGTATAGTTAGGATAGCGACAGCTGAGGTCACGATGGTAGTATTCCA
          AACTCGGTCTTAGTTCGTTTTGCTTTAACAAAATTTGGAGTCTGTGACGCATTTTAACTGGGACTCTCCCACGATGTAGT
          GCTTAGATAAGAAAATGTTGATAGTGTATTGATTTTTAGCTTTTTACTAGTTGTTAAAACGTTCGGAGGTCAGCCAAATC
          AGAGCACATTTCAGTTGCGGAGGCTCCATTCTGACCACAGCTGTCCAGTCCAGCGTTTACCACCGTGTCCATCCCCGTGT
          CCACGCCTCGCCCACACGCACACACCCAACTTCAGAGGACACTCACACAACAACTCAGAGCACTTTCTAATTATTAATTC
          TAATGTATTAATTCTTAAGCTTCGCATTCTTTCGATGTGTTCCTTGCTCTCGTAGTTCTTCAACGATTACTCCTTAGTTG
          AGAGCGAATAAGTTGTTGCTAAATGGATATGTTTCCAGTGTTCCGCACACAAAACAGAACGCATTTCGAGGAGACATATG
          TGATACTGAGATAATAAGTGAAACCAAAACCAGAAATCAAACTCGATGATTTGGCGCCTTGCATTTAAGACGACAACACA
          CACAGCACACAGAGCACAATGAAATTGTTACAGAACACAAGAATGAGCCACATAACACAAACAACACCTAAGCTAAGCTA
          TAATCCTGTATTACCATGTCGGTGGACAATAACAGTCCTAATTGATAATATATATAAACCTGTACCCGCGTACACTCACT
          CGGCATACGATATCAGCAAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0070235
          3623
          FBtr0342738
          3887
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0304566
          711
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0070226
          712
          FBpp0309606
          712
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG12773-RB
          Secondary FlyBase IDs
            References (0)