Open Close
General Information
Symbol
Dmel\CG18304-RD
Species
D. melanogaster
Annotation Symbol
CG18304-RD
FlyBase ID
FBtr0332327
Feature type
Associated gene
Evidence Rank
Length (nt)
6550
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTTTCTCGTCGATTTTCAACGCGTTCGCAGCCGAAAAAAAAGTGCCAAGGAACTGCGCCCGGTTCGCATGGCAGCCATC
          TATATAAGTATTTCGAGTGCTCGGGCAATCGACGGTTATATTAAAGCTATATAAATATATAGGCACATACGTGCTTGGCC
          TTTGTACATGAATGTGAATCGGGTGAAAAATTGAAAACTGCCTGGATCGCATGGTTGATATAAAGATATATCCCTCTAAT
          AATAAGCTATTGATCCAAATCTAACGATATTTCCGGAGAGTCTTGCATTTGAAAATCGTCTGGGTAGATTTATGGGAAGT
          GCGCTGCCATTTAGCAAGAAGAAAACTATGCTATTTATAAAACACAGCCAATTTCTGTGGCCGTAAATGTTTTGTATAAA
          GTGAATATTCCAAAATTAAATCAACCAAGCAGCAACCGAGTGTTTGTGTGTGTGTGATCGAAAGTGAACGAAAGGCTTTG
          GGGATTCCAATCCCTGTAAGAATCTACATATGTACACCAATGCTCCAAACTGCTGTATAATCCGTGTCGAAACGCACTGA
          ATCCCGACGGTTACGCAACCATCAACATCCACATCCACTTCCACATCCAAGAGGCTGGCCCCATTCCCCGTCGTCCAGCC
          GCAAATTATTCTAAATGCGGAAGTATTTCGTAAAAAGAAAAGCTGATAAGTTGTACGAGAACAGATGCATCATCTGTACC
          CATCGCTGAAAGGCGACCAGTTGTGCCCACTCGGCTTTCATCCCCAGACTCGGTATCCCACGCGATGTAAGCGCTGCTTC
          CGGGATTACAAGGAGCATGGAGCCCGCAGAGCCGGCGAAGAGGTGGCCGCCTCCTCGCCCAATCTCTCCGATGCCCAGAG
          TTCTCGACCCTCTTCGCGGACGTGGACGTCAACTCAAAATCTTACCAGTGCAAACGCAACTAATGGCAATGATATAGTTG
          TCCACTTCAATGTAGAGCTGAGGAAGCGTCCGCAGTCATGGGCCTCCACGCCGGATATCGACGAGCCGGACAATGTGGCT
          CGCCGCCCGCCGGCTACGGCATCCACCAGTCGAGCAGCATCCTCCGCCGAGGATCAGGATGTGGCTGTCACTGTAAAGCT
          GCCGGTTCCACCGCGACGCCATACCACCGCCTTGGACATCAAGGAGGTGGAACACGCCATTACACCGCCAACCCGTGTCA
          CATCCTCACCCAGTAAAACTTCAAGTATTCCAGATGAGTTAGTCATCCTATCGACAGACAGTCTAGCAGAGCGTGTCCGT
          AAAATGAATCTTCTCAAGAAGCAGCGCAGTCTCAACTCCCGGGAAAACAGTCGGGAGCGATCAGTTCCGCGGAGGGAAGA
          AGAAAGCGAGTCTACAGCTACACCCACACCAGTGGTACCCGATCGTCCGGAGCGCAGCAAGTCGGGTACTTCCCTAAACC
          AATTGGCCCAAGCCGAACAGAAGCGAGCTGCCCTACCGCCAAAGAAAGTGGCGGTGGCTTCCACCACGACGGCGTCCAGC
          AGTAACAGCAGCAGCACCTCCCTGAAAACCTCAAATTCCACATCCGCCAGCAATGAGGTGAAGGTCGTCACGTCTACGTC
          CAGTTCTTCGACGAGTTCGAGCTCGGTTCGTCGCAAGGAGGCGGATTCAGTGGCTAGCAAAGAAATCAAAAGACAAACCG
          TTCCCGCTGCATCGATATCCCACTCCAACAGCACCAGTAGCACCGCCAGCACTGCATCCAAGAGCCAGGACACAAATGGC
          ATGCAAGAGCAAATGAAGGCGCTAAAACTGGAGCTGGAAACGATGAAGACACGGGCGGAAAAAGCGGAGCGGGAAAAGAG
          TGATATTCTTCTGCGACGTCTGGCCTCCATGGATACCGCCTCGAATCGGACAGCAGCCTCGGAAGCACTTAATCTCCAGC
          AGAAGCTGAACGAAATGAAGGAGCAGCTGGATCGGGTAACGGAGGACAAACGCAAACTTAACTTGCGGATGAAGGAGCTG
          GAGAACAAGGGTAGCGAGTCCGAGCTGCGGCGAAAGCTACAGGCCGCCGAGCAGATCTGCGAGGAGCTCATGGAGGAGAA
          CCAAAGCGCCAAGAAGGAGATTCTCAACCTGCAGGCAGAGATGGACGAGGTGCAGGACACCTTCCGCGACGACGAGGTCA
          AGGCCAAGACCAGTCTGCAGAAGGATCTCGAGAAGGCCACCAAAAACTGTCGCATTCTCAGCTTCAAGTTGAAGAAGAGT
          GATCGCAAGATCGAAACCCTGGAGCAGGAACGCCAAAGTTCCTTCAATGCTGAGCTTTCCAATAAGATCAAGAAACTGGA
          GGAGGAGCTGCGTTTCTCCAATGAGCTAACCCGAAAGTTGCAGGCGGAAGCCGAGGAGCTACGCAATCCTGGCAAGAAGA
          AGGCACCCATGCTGGGTGTCCTAGGCAAGTCGACGTCGGCGGATGCCAAATTCACCCGAGAGTCCTTGACGCGTGGTGGC
          TCCCAAGAAGATCCGCAGCACTTGCAACGCGAGCTGCAGGACTCCATTGAGCGGGAGACAGACCTAAAGGACCAACTAAA
          ATTCGCGGAAGAAGAGCTTCAGCGACTTAGGGATCGCGAGCGAAAGCGTGTTAGATTCAGTTGTGGTACTCAAACCGAGG
          TGCCACTCGAGGTGGTGGCCTTTCCCCGAGGCACACAGACAGTGGCAACGGTTCAGAGCGATATGTCTACCAGTGTGGAG
          AACTTGGTGACCTCCAATGTGGCTGTCACGCAAACCGATTTCGAAGTGCCCGATAGAAATGTTTCAATCGAAAGAGAAAC
          AATGTCGTCTCCATTTGCGGGGCTCTTTCCACCATCGTCATCGTCCAGAGTGGGACAGTCCGGTTCGCTGCTCTTTCCCA
          GCGCCATTTCACATGTCCTTTTGAGTGGAGCAGGTCGCAAGCTGAGTCCCACACCGCATCCTCATCGATTGGCTCCCGAG
          GTCCATGCTGATCGCGATGAGGGAATCTCCGACGAGGATGATCCCGCCGAGCTGAGAATTCTCTTGGAGCTTAACGAGCA
          GGAGGCCTCAATTCTACGACTCAAGGTGGAGGATCTGGAGAAGGAGAACGCCGAGTCCAAAAAGTACGTGAGGGAACTGC
          AGGCAAAGCTCCGCCAGGACAGCTCCAATGGCAGCAAGTCCTCGCTTCTCAGTCTCGGAACATCGTCCAGTGCGGCCGAA
          AAGAAGGTGAAGACGCTCAACGAAGAGTTGGTCCAGCTTCGCAGGACGCTTACCGAAAAGGAGCAGACGGTGGACTCGCT
          CAAGAATCAGCTAAGTAAGCTGGACACACTCGAAACGGAGAACGACAAGCTGGCCAAGGAGAACAAACGGCTGCTGGCGC
          TGCGAAAGGCGAGCGAAAAGACTGGAGAAGTGGATCAAAAGATGAAGGAGTCCCTGGCCCAAGCTCAACGGGAAAGGGAC
          GAGCTGACGGCCCGGCTCAAACGGATGCAGCTTGAGGCGGAGGACAAGCTGCCACCGCGCACCGCCAAGAGGGTAAACGA
          CCTGACGCCCAAGAGCCATCTCAAGAAATGGGTGGAGGAGCTGGAGGACGAGATCAGCGAAATGCGCGTCATGCTCAGCT
          CCAGCGGGACCGATCAGCTGAAAGCCCTGCAATCGGCCAAGGGAGCGCTGGAGGAGGATTTGCGGAAGTGTAAGCAAAAG
          CTTTCCCTCGCCGAAGGCGATGTCCAGCGATTGAAACTCCTGAACGGATCAAGCAGCAAGGTCAGCGAGTTGGAGCAAAA
          ACTGAAACGCGGCGATGAGGAAGCCAAGAAGCTAAACTCCAAGCTGAAGGACTTGGAGGACAAGGTGAAGAAGCAGGAAG
          CCCAACTGAAGCTGGGCGAAACGAGCAAGTCCACCTGGGAGTCGCAAAGCAAGCGGGAAAAGGAGAAGCTGTCCAGCCTG
          GAGAAGGACATGGAAAAACAGGCCAAGGAGAAGGAAAAACTGGAGGCCAAGATCAGCCAACTAGATGCCGAACTGCTCAG
          TGCCAAGAAGTCGGCCGAGAAGAGCAAGTCCAGTTTGGAGAAGGAGATCAAGGATCTAAAGACCAAGGCTAGCAAATCGG
          ACAGCAAACAGGTGCAGGATCTCAAGAAGCAAGTGGAGGAAGTGCAGGCCTCACTGAGCGCCGAACAGAAACGCTACGAG
          GATCTCAACAATCACTGGGAGAAGCTCTCCGAGGAAACCATCCTGATGCGTGCCCAACTCACCACCGAGAAGCAGAGTCT
          CCAGGCCGAACTGAATGCCAGCAAGCAGAAAATCGCCGAAATGGACACCATTCGCATCGAGCGCACCGACATGGCTCGCA
          AACTGAGTGAGGCCCAGAAGAGGATCGCCGATCTCCAGGCCAAGGCTCTCAAAACGGTCAACGGCAATGGGGCCGAGTAC
          GAGCGCACCGTTCTCAAAAACAAACTGGCGGAGAAGGAGCACGAGTATGAGCGCCTGCGTCGGGAGAATGAGATGAACAT
          CGACCTGGTCTTCCAGCTGCGCAAGGATAACGACGATCTGAATGGCAAGCTAAGCGACTACAACCGGATTGAGCAGGCGC
          AATCCTCGCTTAATGGACACGGAGCGAGGCGAGAGGCAGAAATCAGGGAGCTCAAGGAACAATTACAGAGCACTGAACTG
          CAGATGAAATCCGAAGTGGCCACAGTTAGACTTCGCTATGAGCAACAGGTGAAGAATCTGAGCGGAGAATTAACCTCAAT
          GCAGCGCCAGTGCGAACGTTTCAAAAAGGATCGCGATGCATTCAAACAGATGCTGGAAGTGGCCCAGAAGAAGATTGGCG
          ACCTCAAGGCCAACAATACCGGAAGACAGAGTCGCGGCTCCATGCACAGCAGCGATGATGATGATAAGAGCAAGATTGCC
          TATCTCGAACAGCAGATTGGTCATCTGGAAGATCAGCTGGTCGAGTCGAGGCTGGAGTCCAGCAAGATAAAAACGGAGCT
          CGTCTCCGAGCGCAGTGCCAATGAGATCAAGATATCGGAGATGCAGTCGAAGCTCAACGAGTTCGAGGAGGAGCGCGTCA
          TCGGTTCGGGCAGCACGAAGCTGCCGGGCATGAAGACCAAGCTGGAGCTGTCCTGGCAGAAGGAGCGCGAGGATCAGCAG
          CGATTGCTGCAGGAAACCTCCACTCTGGCGCGAGACTTGCGACAGACTCTCTTCGAAGTGGAACGGGAGCGTGACAAGGA
          GCGGCTGGAGTCAAAGCGCAAGCTGGACCAGATCAAGCGGGCCACCGAAGAGGAAATGGAGGAGGGCCGCAAGAAGATCG
          CCGAGCTGCAGTGCGATCTCTTGGAGCTCCGGGACGTACACGCAAAGCTGCGGACCTCCAACGAAAAGCTGAGACGAGAG
          CGTGAACGCTATGAAAAGGAGCTGATCAAGCGACGCATGGAGGCAGATGGCGGAGACCGTAAGGTGGGCGCCCTTTTGCA
          GACCGTTGATGAGCTTGTGAAGATAGCTCCTGACCTGAAAATAGTTGGCAGCGGCGGATCAGCTCGAAGCAGCAGCAGCT
          CTGGCTACGACAAGAACTTGCGACCGGAGCAACCCAATGTGCGCCGCAGTCGCTCGCCTTCGCCCACTCTGAGCAGTTCC
          CAGATCACCAGTGTCCTGGCCAGACTGGCAGAAGCCTCGGAGGAGTTGCGCAAGTTCCAGCGGGTCAACGAGGACGAACA
          GGAGCGCAGCCGAATGAGGAGGAGTAATCTGCGTCGGGCTGCTTCGCAGGAGAACGATCCGCATGGCAGCACCAGTTCGG
          TGGCAAGTGCGGCAGGATCGCAGCGAGGCGGTGGACGCTTGTCCCGTAACTCCTCCAACAATGGCAGTCTGATTCGGAAG
          AGCCTCTCACTTGATCACTCCATACAAAGAGATCAGAATATTTGGCGCCAGGACGATGGCAGCGTGTCCTCCATGCAATC
          CATAGACTCTGAGCTGGGTGGCCTGGTCAGGGACTCCAGCTTGGACTCGCGCCTGGATTCGCGGCTATCCGGTGGATCCA
          CACAGAGCGACATACCTCGAGGACCTCGCAAGAAGAAGAAGGGCATCATGGGCAAGCTGCGCAGCCTGACCAAAAGCAGT
          CGCAATTCCGAGAGTGAAATTTCAATTCAAGGATCTGACTCGGACATCAGCGTGGCCAGCGACATGAGATCGAGCAAGAA
          GGATCTTCGCGGCCGACTTTCCGGCATGTTCAAGCGCTCCGGATCCGCCTCTCGCAGCGAGAGCATGGAACGTGCCGGTT
          CCGACCAGAGACCCGTGGCCGTCACCGTAGTGGGACATCCAGATGGACCACAACCTCGCGAGCCGCCGCCTGCCAATTCC
          CTTACACCAAGACCCATACGTTCTATCCCCAAACCACCGAGCGCCGGAGCACCCACCACACCAACGACAAGACGACGCGT
          AGCCAAGTAGTGACCATCGGTTAATAGGTTTCAATCTCATAGGATTCATTCTAATCGTAGCTGTAGAACGTTCGAATAAC
          CCTCGCTCTCATTGGCTTCCGAATTGCAATTTGTTCTCTTGCCAAGTCATCATAATTATTTGTTGTTTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079367
          6532
          FBtr0306285
          6304
          FBtr0332326
          6286
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0304605
          1901
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078995
          1895
          FBpp0297395
          1819
          FBpp0304604
          1813
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG18304-RD
          Secondary FlyBase IDs
            References (0)