Open Close
General Information
Symbol
Dmel\CG42541-RE
Species
D. melanogaster
Annotation Symbol
CG42541-RE
FlyBase ID
FBtr0332388
Feature type
Associated gene
Evidence Rank
Length (nt)
9704
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTAACATATCAGTTAAAACATATGTACTTACGAAAATATAAAGTGAATACCATCCGAATTGAAAGGAAATCTTGAAAATC
      GTTGTCAAATTTACAATCAGTGTTAAACAACGGAAGGAAGGAAATCCAGGCATTGAGAGGATTCTGAAATCAAAAACACA
      TCTGAATTTAAGTTTACCATCATCTGAATTTAACTTAACATCAAGTAGCAAATATCAAATATATATAATCACTATAATAA
      ATTACATATTTAGTGTGAATCGCATATTTAATCCCAAATCTATATATCTTAATCTTAATCAAAATCTGTACGATCAAGAG
      TGTCAAAAGCATAAATCTAAGAGTGCAATCAACTTGATTGAGACTAGAAAACCTATATCGAGCTATGTAATAATATCAAG
      ATTTTAGACAAGTCTAAGTGAACACAAGTTTATTGTTCTGTACAATCTGTTTCTTAATACACCATAATCGAATATAACCG
      AATAGTCTTAACAAACCCATTGAGAAAAGCTATTGAAAGTACGCTGAATATTATTAAGAACACTAAGAACCATTGATATA
      AATGAACATACAAGAAGAGCTTAAAAATGCATCCCATACTTGATCGTTACTATAGCGATCGATATCAGATCAAGCTTATA
      ACCCGATATTTGATCGAACTCCTTCGATTGCGAAAGAAAACAAAGCGCACTTCCGAATTATCGGAGTAAAGAACTGAACT
      GAAAAAAAAAAAAATAAAAATATAACAAGCCATCGTTTTTAAAACCCGGTTTCAAGACACCTCATAAAGAGTCCAAATTG
      AACCATATCGAACTCAAAACCGAACTTATGATATAAACTGTATTCCCGAAATTGAGAACATTGAAATCGCGGTCGCAGTT
      CGCTACATCAAACCGATGTAGTTCCATTGATGCTTTGCAACCGGAGCGCTCATTCCAAGCCGAATATATTCATCATGAGT
      GTCCAGGGCCGCCCAGGATATGTGATCACATAAGGACAACGCCAAGTCGCAGTTGTTCATAAAAGAAAAAATTGAAGAAA
      AAAACAGAGGGATAGAGTGAGAAGGAGAAAGAAAAAATATATAAAAAAATAAATTGAGCAGAGTTGTTGACGCGACATGG
      ATACCAAGTTGGAGGCACGTGGCCAGTTTCCGGCCTCGTTTCCGGACACATTCAAGAACTTCTTTGCCATGATGAACGAA
      GACGAGGATCATGTGGGTCTCTTTGCCAATCTGCTGGAGGATAAGGTGATTCCGCGCCAGAACAGCCCCGTGCAGCCCCA
      GCGGCAGCGGTACGGTGGCAGCATGCGGAGTCACAGCGGCGGCGACCGCTCCGATCGAAGGGGTCGCACCGAGCGGCAGT
      ACCAGCAGCAGATCCAGAATCATCATCATCATCATCAGCAGCAGCAGCAGCAACAGCAGCAGCATCAGCAGCAGCAGCAA
      CACCAAGGCGCCCAACAGCGCGTCTTTCAGTCGCGCAGTCGCAGCGGCAGTGGCAGCAGCGTTGACCTTTATGCGAATCG
      CAATGTAAGTTTCTCGACCACCACCAACCGGGTCAATTCATTGCGGAGGAATCGCTCGCGAGGATCGCTGACCACTCTGA
      GTAGCAATGGCTTAAATGCCCTGGGCCTGGGACCCGTGACCCTTGCACCGAATGTCAGCTCGAGCAGCAGTGGCAGCGTC
      CTGGACTTGACCTTGCCTGGTGGCACTGGCACTGGAACTGTGGACGGAGGTGGCGGCGGCGGTGGTGGCGGAGCTGGATG
      CGGTGGCCAGAACGTGTATCCTTCGCCCGCAAAGTCAAACCTGAAGCCCGCTCTGAAGGCGACCAACTCGTCGGTGGATC
      GTGGATGCGCACTCTTCGTTGGAGTCGATGGTGAATTTCATTGCGGTCACATCAAGTACTGTTCCCTGCACCATGACAAT
      TTCGCAGATGGCCTCCAACAGCTCCAGCAGCAGCTCAAGAATCAGCAACTCGGCTCTGGACAGAAACACGTAACTATGGC
      CTGTTGCGAGTGCGTTTGCGGCAGTGGCAAGGCTGCCCGTTCTGGACCCGATGGCGAGGACAATTGTGGGGCGAACTACC
      TGAAGGGCTATTCTGGTGGATATATGCTACCACCGACGCCGAAGGGAAAGTCCATCGACAAGACGAGCACCTTCACTTCC
      GCCGAGCTGGCAGCCTCGAAGAACAAGGATCTGCAGGAGCGACAGGAGCGGCAGGAGAAACGTGGGTCGGTCATCCTCGA
      AAGGGCCTTCGATTTCGATGCCAGCTGCGACGAGAGCGACAGCATAAGCAGCAGCACCCACAATCCCGTGCCCTCGCCGG
      CTCCGCACCAGCTGGCCTACAATGTCCTCAAGCCGATCCTCAAGCAGCCGCAGCAGCAGCAGCAGCAGAAGGCAATGCTG
      CAGGCGCAACATCAACAGGTAAATGTACAGCAACATCAAGGAGTTACGCAGCAGCAATATCAACAGGCGACGCATCAACA
      ACTGGGCAACCAGCAGCATCAAGTGGTGACCCATCAGCCCCATCAACAGGTAACCCACCAGCAACATCCAGGCGGAGGTG
      TCCACCAGCAGCACCAAGTGATGGTTGCTCATCAGGCACACGCCCATACACAGGTTAGCAACCAGCAGCCCGTGCTGCAG
      GTTCAGCTACCGACACCCGGGGTGCACGTGGTGCACCGCCTGCTGCCCACACCGCCCACCCATAGTGGCAAGGGGGCGTA
      CCACACGCGTGAGACGGCCTTGCAGCGGGTGCAACAGCAGAGTGGCTATTACAACCAGGGGCCGAGCACCTCGGCATCTG
      CATACGGCTATAACCAGGCCATGGAACAACAGCAGATGCAGCAGCAGCTGCACTACGATCCGCATCAGGAGCTGCAGTTC
      GAGCAGCATCAGCCGCACCAGTCGCATCAGCAGCAGCAGCTGCAGCATCAGCAGCAGCATCAGCTGCAACATCAGCAGCA
      ACATCAGCAGCAGCAGCAGTATCAGCAGCAGCAGCACCAGCAGCAGCAGCATCAGCAGTACGCTGATGACACCGAGCTTG
      ATTACGATACGGAGTGGGAGTTGGATGAGGAACCTGCTCCTCAGATTGTACCGCCACTCACCACCTTCAACGATTTCGTC
      AATGCGGCTCAAAATCCAACTGGCAGTCGTCAGAGTCTGCGTGCCCAGAAGTCGCCGATTTTGAACAGACGTCGCGCCTC
      ATCTATAGCCGGAAATCTTTTGCACTCGGATTACACGTACACCCGGAATAGCATCGGTGGAGCTCCAATCGACTCCAATG
      ATTTTCAGCGCATTTCGCACAGCAGCAGTGCCAGGGATCGCATGTCACTAGCCGGAGTCCTGACCTTTCAGCAGGCCATA
      TCTGGAGCTGTGTCACCACAGTATGGCACAGTGGGATCGCTAAATTCCCAGGTACCCGCTACCGGTGAAGCCGGAAAGCC
      GGGAATTGTGGGATCCGATGGCATTGGCGGTGGCGGTGGCGGTTTACCTGGCGGATCTTCACACAACTTAAATTTGACGG
      TGGGCCTGGGGTTTCTCGGTGGTTCCAGCACCACTTTGGCTGCTGTCGCCGAGGTGACTAGTGGACCGGATGGCAATGGC
      GACTCCACCGACTCCCCATCTCCGGTCTCCATGATTCCCAGCAATCAGCAAAAGCAGCAGCAGCAACTGTTGCAGTTGCA
      ACTGCAGCAGGAGCAACAGCATCTGCCCACCCATTTGCCCATGAAGCGGGAACGAGGCGTAGGCGAGTCCTCGGGGGCCA
      GCACATCCGGCACCGCCATCGCCGAACTGGCCTCCTCCGTCGTCCTGGCCACCCAGTCCGGCAAGCCGATGACGGAGCGA
      CAACGCTTAAGGACATCCAGCATGCCGGCGGAGAGTAGAAGGCCCCGCCTGGCGGAGATGCGACGTTCGGCCATCCATGC
      CGGTGATCCGGACATGACCTACTACCGTCTGCGAAGCTTCAGCATCACCTCCCATGGCATCTGCAATTTGGGCGATTCCC
      TGAGAAGCCGCAGGTCACGTTCGATCAACTCCGTGACTTCCACCGGCACCTCAAACAGCGGCGTGGATCGACACAATAGC
      AACGCATCGGGGGCATCGGGCGAAGTCATCGACGGGGATCCCAATGTTCCAGCCTACAAAATTGCCATGCTCGGCGCCTC
      CGGAGTGGGCAAGACCACACTGACTTACCAGTTCACCACTTCCGATTACATATGCGCCTACGACCTGAGTCTCGATGATG
      ACTACGGACAGAAGACGGTGTCGGTGCTGGTCGATAACATTGAGACGGATTTGGAGATTATTGATCATCCCGCATGCGAG
      ATGTCGACGGAGGCCTTCTGCGCCACCTACAACATCGACCTCTTCGTGGTGGTCTACTCTGTGATAGATCGAAACACTTT
      CGCAGCAGCCGAGCGTGTCCTGCAGTATCTCAAGGAGAACGAGATGCTCTTGTCCCGCGGAGCCATCCTGGTGGCCAACA
      AAACGGATCTGCAGCGACACCGAGTTGTCACCCGTCAGATGGGTCGCAAGGTGGCCAAGGAAATAGCGTGCAAGTTTATC
      GAGACGTCCTCGGGACTGGATCACAATGTGGACGAGCTGCTGGTCGGCATTGTGGCCCAGGTGAAACTCAATCCGCAGCG
      TTTGCGATTGCTAACGGAATTGGAACTGCAGCGCCTGAATCTGCAGAGTACCATCCAGAAGCACCGTGGAATGCACCTGC
      AGACGCGTCGGATGGTCCGCCAAATGAGCGTTTGCCAGGGCGACGAGGAGATCTTCGATGGCGGATTGCCGGAGGGGCTG
      CAGAACGGCGAGGCCAACGATGATCCGGACGGAGTGCCTAGCACATCGAAGGCCAGCCGGTCGCGGATCGAGAATCCCAA
      CCGCAAGCCCTTAAACCTGGAAAGCATATTGAAGATGGGCGAAAGCGAGGTGGACGAGGATGAGGATGTGGTCAAGTCGT
      CGCAGCTGAGCAAATTCAATATGCTGGCGGCCTCCATACGTCATCGTCGTCCATTCCGCAAGCGTCGCTCGTTCGACGGC
      GGCGTTACCACGTCTGCAGCCGCGGATGCAGCCGCCGAACTGCAGCGGCGCTATCAACTCCGGGCCATGGATGATCTGCA
      GCTGGAGGGACGACTGGCAGGAGCGACGGAGGAGCGGTTCGGGGAGAGAAGTGGACTGGCCGACAGCGATGACGAGGAGG
      ACGGTGAGGACATAGTGAACGGAGGACACCGGAATGCCTGCAACCGCAAGGTGGTCAAGAAACTAACCGCCCGCACCAAG
      GTATTCATCTCGTCGGTGCTGCGCTTCAAGAAGGCCATCAGCCTCAAGCGGCGCAACTCATCCAGCTGCAGTGATCTCTT
      CGTGATCTAAACGTTTGGCGGCGGCAGCATAGGAAGTAGGAAGCATAGACTGAATGTACATAAATGGAGTATAGATGGAG
      GCGAAGTAGGAGCATAGATATGGAAGCGAAAACGGAAACGCAACCGAAACCGGAACCGGAACCATCCAGACCAGTAGATC
      CAGAGATCAAAACAAGCACAACGAAACAGCAGCGCAAACCGAAGTGGAGTCGAACACGGAAGTGCAGGAGTACAGGAGGG
      GTCAACTTATGAGGAAGTTTCCAGTTGCATATTCCATAAAAACTACAGGGACAATTTCTGTTTGATTGGCCAACGGACGT
      TTGCAGATTCAGTGCTATAGTTTATGCACAGATTTTGATGGCAACTGCGACTCGTCGGGCGATGGCAAGCAATATGAAGT
      TCTGGGCCAACAAATTTCTAGAAACTTATAATCACTTGAAATGGCATTTAAAAGTGTGGTCTAGTTATCCGTGCCCGTGC
      GACTTGCGGACTGAAAATATATTGTAGACAAACTTTGGAAACATATGTAAGCGATATTAAGCATCTAGAAAGTTTTGAAC
      AGGCTAATAGCATAACATTCAAAATAAAAAGCAAAAGACATACCCTTTTACCACGAACCCAACCGGTAGGTGGCGCTGCA
      AATGCGGACAATAATTTTCTTACAAAAAATATTGATCAGCAAATTTTACAAAATCGAAAATCCAAAATCGAAAAAAAAGG
      ATTAAGCAAGTTATATGCAAATACAAATCGAATCGTATCCGCTTAAAAACAAAATGAAAAATGCAGCTAAAATGAAAAAA
      AAAAAAAACATAAACAGACTTCTGCTTTGTTTGAGTGGCACATACATACATACTCGTGGAAACAGGAAAAACCGCAATTG
      CAATATACATACGACATACATAATATGTATGTAGAAATACAGGGCAAGGAATTGCACTCTATTTTGTTATGTCGTATTTG
      TGGTTTCTAGTTATGATTAATCGCGTGGTTTCTGACAAGTTTCAAACAAATAATTAATTGACTTTATAGCATAATGCATA
      TATGGCAAAAGGCGTTGAGTAATATGGTGAAATTATGAAAACGTTTTTTGTTGTTGTTTTTTTTTCCAACCAATGAACAT
      GACACACATATGATGTATTGTATGTATGTAGACAGGAATTCTGGCAAACCAATTGAAGCCAAAAAGAGCAGTATGAAATA
      GTCCAAACACTTGTGCAATCTTTACATCCTTTTTATTTTAGAGTGGCATAATGCCAATGGTCCAACTTAATGGCTCAACT
      ATTAACGCACTTTTTTACCCTCTTTTGTGATAGTCTTATAGTTGCTTCTTTACCAAAAAAAAAAAAATAAACCTTCCACC
      AACAATGTAGGCATTAATATATTTTTCCTATATTAACTGCAATTTACAATAAAGCAATTTGAGAGCTTTTTGTAAGATGC
      GCACCCTTGGAACTGCTGCTCGTTTGGCTATTGCTGAACAATACATATACATATATTGATACATGAAAAAGAAATAATTG
      TCTAGCGCCGAGTTTTTTTAAAGATAAAAAACAATTTTTTTGCGCGTCTTTGATCAAGAATAGGCAAATAAGTATTTTAC
      ACTTCTAAATGTCGTGTGGTAAGAATACCGAAAATACACAGAAACCACCAGCACTACATAAAGTACACATATAAGAAAAA
      AAAAAACAACAGCAGATATCATCTGAACAATGAAACAAAGAGTTACAGCAAATGGCGCCCGAACAGGGATTTGGCCGCTT
      ACTACAATATATATACAAAACACAGAATATTCAATATTAATAGCTTATGAATGCTACCAAGCGACCGCATAACGCGAAAT
      CAGAGGAAAAGAGCAACTATTAATGCCAAATCTTCAATGACATCTGAGGTGGAGAAGAAGTACCTCCAATGACCCCTAAG
      TTTTTCCAATTGCTTTTGTAATTCCAAATTCCGTCGGTCGTTGGAATGCGAGCCACTCAGGCAAAAACCATAATGAGCTT
      AACCAAAGCCTGCAATACTGTCTTCGAATGGAATAGGCACGAAATAATGTATACAATTGCTGCTTTTGGAAATTTCTTAG
      CGACTACTATCGCAAACTAAGAAATATAGCATATAGCACATGGAATATCGACCAAGCGACGCGGTTTTCACAATAATTTA
      GTTTTACCTGGTTTTTGCATTTTTGGTTCAACTTTTTAAATTGTTTCTACCTTTTGTTCTAGGTGAATACAAACTGTTAA
      GTATATTAACTGCATTTTGACAGCTGCTTAAATTATTTACTTGCCTTATTAGTTTTGTTGTTAAGCTCTTTCAACTCACT
      TTGTAATAGCTGGCAAAGTTTTTGGTAGGAAAGGCGGTCTTTAAAAACCGAATACAAAAGAAAAGAAAACAAAGAAAATA
      AGTCATACATTCCAACATTATTTTTTGGGCTGTCCGCACAAGCGGCAGCAACAACAACAAGTAACTTAGGTACACAAAGT
      CAAGAACAAGAAAACTTAAACAAATTGAAATACAAAAAAAAAAAAAAACAAAAAAAAGAACACACTCAACTCAGCCACAA
      GAACTCCCCCTGCTCACTCCTCACTTCTCACTCCTGTCAAACAATTGAAAAATATGGAAAATGCTGGCAAGGAATGGAGG
      AAGAATTGTATTGCTCAAAACGAGAAGCAAGACATTGGACGAATTTCGAGGGGGAATGAGACGGTGACTTATGTGCCATC
      TAACTAAGTACTTGGCCAGACTTGATCGGAGCTTCCAGTTAACGGGAGCGCTAGAAATGGCAAAAACAAAAAATGGAAAA
      AAGGCAAAAAAAAAAACACATTGAACGGAACAACGAATCGTGAATGACCTAAGTTGGAGATTAAGTGCAAGTGAAGCGAA
      TGCGTATGACACCACATCTAATATCCAAGTCAGTTTCGTCAACTCCCATCTGACATGAACCTCTTTCGACCATAACTCCA
      ACGAAATGACTGTGCTGAACTCAGCTGAAAGTCCAGTGGCCAAGAGGCTTAGCGAGTATATATTTAACTGGATCAGATTT
      AATGGGGCATCGAATTCGATTCGTGGTGGGGCAACAGAAACTGGACATAAGCTGGGTCAAGGGGAGGAACCCTGGACAAG
      GATCTGGGCACACTCACTCTAGCGGACAGGAATCACTACGGAACTTCACCCACTACTACCTACTACTTCAAAATCGAGAC
      TGATTTTACTGCTTACCCCCTGCCTCCATCACCCCCCCCCCCCCACCACCACTCACCAACCACAAGAGCACACAAACAAA
      GTGTAATACATACAAAGTACATACAATACATACCGGAAACGGAAGAATATCAGAATATCAACCTGACAATCTGAACTTCA
      ACTTTCATAACCTATTTCGCGTACACTATCGACAACACGATAATTTAAGAATACATTTACAAGTTATAGAACCTATCGGT
      TGGATAGGGTCGAATATACAAAACTACTTGAATACAAATATATATATATATATATATCTTATATAATTATATACCCCTAT
      TATATACATATATGTATACAAAATATATACGATGAAATATTTACACACAAGTTTTACTCCGTGCCATTTGAGTGCGATAA
      GTTAAGTTAAACCAAACTTTATACGAATTTCGGACAAGTTCAGCGGCATTTTTATGGGAATCCATTTGACTAATGGTTAA
      CTTGTTCTTATATATCATTTAAGTGTGATACGCGAACGGAGATTTAGTTATAGAAAGCCAACTGGTGCTCCCTACAATCC
      TGTCATTTATTTCTTGATCATCCCCCAACCCACTTTCACTCCGTTCGAATCAAATCAAAAATTTAACAAAAACAAAAAAA
      AAAATAAAAATATGTTCCCAAATAGTGTCATTTTTTCCTTACAAAATTGTTTACAAATCAAAAGACGCTGTAGTTGTTTC
      TTTTATACACGAATATACACTATGAATACTTGAGATTTTTTGATGTACGTTAAACATTTATGATATGTGTGTGTTTGCAA
      GAACCTCTATTTGTAATTGATATCCATATATATATGTATATATATCTATATATATATATATATATATATGTGCATATATA
      TATATAGAACGACAATTTGCTCTTCTCCCGTCTTAATTCCGAGTGATTTTGAAGTTTCCAAGCAAAGCAATTGGTTTAGG
      TGAGCAAAGGCAAAGATGGTTCCACGTGGAATATATTGTAGAATACATATATGGAAACCACGATTTAGTACGTATGCGTA
      AGCATTTGTAATTCATATTTTTTTTGCGAGAAAACCTTCATTCAATCAAATTGAATGGGCACTTTTAACCATAAATAAAT
      ATTTTACTCTATGTGTAATTAATT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0301099
      6157
      FBtr0301100
      8817
      FBtr0332389
      8763
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0304662
      1417
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0290321
      1418
      FBpp0290322
      1417
      FBpp0304663
      1399
      Comments

      Extended 3' UTR based on RNA-Seq and/or EST data.

      UTR(s) based on RNA-Seq data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG42541-RE
      Secondary FlyBase IDs
        References (0)