Open Close
General Information
Symbol
Dmel\CLIP-190-RT
Species
D. melanogaster
Annotation Symbol
CG5020-RT
FlyBase ID
FBtr0332455
Feature type
Associated gene
Evidence Rank
Length (nt)
1549
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 7 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTTACTTGAACGACTTTTCGCGAGGCGGACGTGTTTCAGACGCGGAATTGCAACTCAGATGGCAACCAATTGAACTTGA
          TCGGCTCTATACTATAGCTTATATAGTGAACACGCAAACGAAATTGAAAATCCAAAATAGAAGCCAACTTTAACAGAGAG
          ACTTACTTATTGTTATACAACTCACAAAAGAAGCCACCAGCATGAGTCGTGAAAGCGATGACAATTTAAGTTCGATCAAT
          TCGGCTTATACAGATAACAGCAGCGCCGTGCTGACAGCAAACACAGAGCAGTTCATCATTGGACAGCGGGTTTGGCTGGG
          TGGCACTCGTCCCGGACAGATTGCCTTCATTGGAGACACACACTTTGCTGCTGGCGAATGGGCGGGTGTTGTCCTTGACG
          AGCCTAATGGTAAAAACGATGGCTGTGTGTCGGGCAAAAGGTACTTCCAGTGCGAGCCGAAACGAGGCATTTTCTCACGC
          CTCACACGTCTTACCACATATCCCTTGGCCGGAGCCCAGACTCCGACCTCTCCATTGGCCAAAAGCTCCCCAGACAGATC
          GCGCACAGTTTCTCCAACTGCGAGTATTCGCAGCTCTATGCTTCGCAGTCCCGGCATTGGAGGCAAGAATGGAATGGCTG
          TGGGCGATCGTGTGATTGTCTCTTCTGGATTTGGTAGTCGTCCTGGTATCTTACGCTATTTGGGAGAGACACAGTTTGCT
          CCCGGCAACTGGTGCGGTGTGGAATTGGATGAGCCTAGCGGCAAAAACGATGGAACTGTCGATGATATCAGATACTTTGA
          GTGCAAGCCCAAGTACGGGGTGTTTGTACCTATTGCGAAGGTTTCACTGTCGCCGTCGTCCAAGAAAACGCGTCTTTCCA
          GGACCGGATCAAGGGAGTCGCTCACCTCGATTGGCACCATGAACAGCATCGCCACCACGGCCACGTCGCGCATGCGCATG
          AATGCTCAGCAAATACTGATCGAAGCGGATCGCTGGAGACGCCTGATAGCGAGACACAGCATAAAGGTATCCGATCTGCG
          ACGCGAGTTCCGCGGCTGGTCCGGAAAACACGAGAGTCACTGCATCCTGCACAGTGTCCTCACACCGCTGCGCATCAAGT
          AGAAATCCGGATGAGAGGAATGGGCGACCATAGTGCTCAAAACTATTCGATTCGACGATTTTTGAATTACATTTCTTTGC
          ACCGAGAAAGGAACCACTGAAGACAAAGTTGAAGTCTGCACAGCGTTTTAAGCTGATACAACCAAATAAAGAATTAAAGA
          TCTTTAAAATAATGAAAAAAGGAAACCATAAAAAAAAACGAAAGCCAATCGAAAAACCAAAACGAATAAAGTTAACTTAA
          ATGGTTTGATTGGCGTAAAAATATCAAAAACGAAATTAAAAAGATAAAAAAAACGGTTAATGGAAAAGTTGACTGACAAT
          TTTCGATTCTTTTGACGAAAGCGAATTTTTCTTGCTGTTGGTTTAGTTATTACGATATACACTTAAATACTATATATATG
          AAGAAAAATACACTAACAATATGCAAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0080976
          5917
          FBtr0080975
          5625
          FBtr0080977
          5453
          FBtr0290262
          1723
          FBtr0290263
          1615
          FBtr0301440
          5851
          FBtr0301441
          5291
          FBtr0301442
          2664
          FBtr0332451
          5349
          FBtr0332452
          1900
          FBtr0332453
          5283
          FBtr0332454
          5806
          FBtr0339796
          1357
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0304728
          306
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0080529
          1690
          FBpp0080528
          1689
          FBpp0080530
          1652
          FBpp0288701
          365
          FBpp0288702
          328
          FBpp0290655
          1668
          FBpp0290656
          1598
          FBpp0290657
          456
          FBpp0304724
          1623
          FBpp0304725
          311
          FBpp0304726
          1601
          FBpp0304727
          1653
          FBpp0308841
          327
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CLIP-190-RT
          Secondary FlyBase IDs
            References (0)