Open Close
General Information
Symbol
Dmel\ab-RB
Species
D. melanogaster
Annotation Symbol
CG43860-RB
FlyBase ID
FBtr0332557
Feature type
Associated gene
Evidence Rank
Length (nt)
4840
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 80 )
Sequence
CGCAGTACAATTTCAGAAATCAGACGGGCAGCAAGTGTCGTGGTTCAATTGTGCAGTGTTGAAAAATCAAACTAAATTCA
AAATCGGCTTTAAAGAAAACAAATTCATAAAGGGAAATACCCAAAGAAAATAACCCTCAGTGTTTCAAAAGTGTTCAAAT
TTTACAATTGTGGCATCACAACAACAAATTCAGCAATCATCGTGAATTTTCAAAAAGAAGATTAAGAAATCAACAGTGCA
AACGACACTGAGTTGCAGCTGAAAGTGGAAGAAGCAACTGCAGCAGCCGCATAAAATTCGAGAAGAATAGACAACGCCAT
TGGGAGAAGCAACAATAGCACTTGGATACCCAGCAGCAACATCCATAATCGAAAGCTAAGCCACATCATCGAAATCTTCT
GGCAGTGTGGTAGCAGCATTAACCAGCAGCAACATCATTTAGCTCCGTCCATGGGCGCCGCGGCAAACAGAGTCCGGTGA
AAATGGACAAAGGCCGCGCGAGGCTGCCGCCGAATTAGCAGAGAAGCCGGAAAATCCGCACATACGGACGGGCAGTGCAA
ATATTTGCCAGGCCCCCAAAAAAAAAGAAAGAAATATTAAAAAAAAAAGAAGAACACACACATATAACAAAGGCGCTCAG
AAGGGGAAGCATTTGTGCGACAATAGCCAAGGAATTAGCCACAAAAGAAGGAGCAACCGGGTCCATTAAGACAGTCAAAC
CATCCGATCCCATCCCGGCTAGACGAGGTCCACTTAAATGACCGAATCCACACAGCTGCAGACGGCGGAGAACAACAACG
CGGGCGTGGTCAAAATGGAGCCCCCGCCGCCGGCGACCTCCTCCGTTTCCGTATCCGCCGCCGCAGCCGCCCACGCCCTC
TCCTCCCTCTCTTCGCTTACAATGGCCGCCACCGGATCCGCCCTCTCGCCGGCCACGCCCCCGCCCTCCCTGAACCTCTC
ACATCAGCAGCAGCAGCACCAGCAGCACTACGCCCTCAAGTGGAATGACTTCCAGAGCTCGATCCTCAGCTCCTTCCGTC
ACCTGCGGGACGAGGAGGATTTCGTCGACGTGACGCTGGCCTGCGACGAGCGTTCCTTCACCGCCCACAAGGTCGTCCTG
AGCGCCTGCAGCCCCTACTTCCGCCGGCTGCTCAAGGCCAATCCCTGCGAGCACCCGATAGTCATCCTGCGCGACGTGCG
CTGCGATGATGTCGAGAATCTGCTGAGCTTTATGTACAATGGTGAGGTGAATGTGAGCCACGAACAGTTGCCCGACTTTC
TGAAGACAGCTCACCTGCTGCAGATTCGCGGTCTGGCGGATGTGAATGGTGGCTATCCCTATTCCAAGGCCTTGTCCGCC
GCCTTGAGTCACAACAGCAGCAATAACAACAACAACAACAGTAGCAGCAACAACAGCCTGAGCAACAACAATAACAATAA
CAACAATAATGCCGAGAGCAGTAATCATAACAAGATAAGCAGCTATTTATCGCCCAATCAAACGAGCGCCGCGTGCAACA
ACAGCAGCAACAGCAATAGCAACAACCACAGCAGCAGCCACAACAACAGCAGCAGCAACAACATAAGCGGATCCCTGAAC
AGCAGCCTGAACTCACCGTTTAGTGCGCCACAGATACCGCCACCAGTGACCGCATCGAGTGCAGCGGCAGCAGCAGCAGC
GGCCGCATCCCTGACCGCCGCAGTAGCCGCAGCAGCGGCAGCAACAGCAGCCAGTGCCGGCAGCAGCAGCAGCGCCGCCA
GCGGACAGACGAGCGGTACGCCCGCCATCCAGGAGCTGAAGGCATCGTCGGCAGCGTCGCCCGCCAGCAGCAGCAACCAC
TGGGACATGGGCGAGATGGAGGGCAGCCGGAAGAGCCATCTGACGCCGCCGCCACAGAAACGCATCAAGAGCGCCGACTT
GTTCCGTGCCCAGCATGGCATCAGTCCCGAGCGATTGCTGTTGGATCGGGAGTTCCCCGTCGCCGGACAGCATCCACTCA
CAAGGAACAGAAGCGGTCGGGACACATCCAAGGATCGGGAGCGCAACTTGGAGTTGAGGGAATCGCTACTGGGACAGGCT
TTGGAGAACAGCAACGGCCAGCAGGCCAATCCGAAACACGAACTGGGACAGAGCGCGGGTGAAGATTCGAACAGCAGTGA
TACCGAGCCCTCGGATCGCGGCGATGGTCAGCACGATGGAACCCTCGACGGGATTGACAACCAGCGCTCGCACTCGTTCC
CCAATGCATTCCTCGGCCTCCAGGGCATTCCAGGACTTCTGCCAGGACCCTCTGGCATCAACAGCGATTTCGTTTCCCGA
CGCTCCCTGGAAATGCGAGTCCGAGCCACAGATCCGCGTCCCTGCCCCAAGTGCGGAAAAATCTACCGCTCCGCCCACAC
GCTACGCACCCATCTGGAGGACAAGCACACCGTGTGCCCCGGCTATCGATGTGTGCTCTGCGGCACGGTGGCCAAGTCCC
GCAACTCTTTGCACTCGCATATGTCGCGCCAACATCGCGGCATCTCCACCAAGGACCTGCCCGTCCTGCCCATGCCCAGT
GCTTTCGATCCAGAGCTCGCCTCGCGCCTTCTGGCCAAGGCGGGCGTCAAGATCTCACCCGCTGAGCTGAGGGCCAGAGC
CTCGCCCACCGGCGGAAGTGGCAGCAGCGGCGGAGGCGGCGGAGGTGGTAGCAGCCAGGCCAAGTTGGATTTAAGCAACG
CTAGCGGTGGACCCATGGACGATGCCGAGGACTCGGACGACGATCCCGAGGACCTGACCACGGGCAACGGATTGTATGGA
ATGGGCGGAAGCAGCAGCGACCTGAGCCGTTACCACGAGAGCCTGTTGAGCAACTTCGGTCACGCCAGGATGCGAAATGA
GGCGGCTGCCGTGGCGGCCACTGCAGCTGCTCTTGGTCAACCCAAGGACTTGGGCGTTCAGCTGCCAAACAGCAACGCGC
CTGGGCAATCCCTGCTGGACACCTATCTGCAGTTCATCACGGAGAATACATTCGGCATGGGCATGTCCCAGGAGCAGGCC
GCTGCAGCAGCACTGCGCGCCAAGATGGCCCAGCTTAACGCGATGGGACACAGTCTGGACAACCTGCCGCCGGGCCTTCT
TCCCGGACAATTCGACCTGAGCAAGCTGGCCGCCGGAAATCCCGCCTTTGGACAGAGCGGACCCGGACTAACCATTGAGC
CGATAATGCGACACGAACAGGCAGCGGGAAACCTCTCGCCGAACCGACCACTGGCTCTCAACTCGGGCGGCAGGATGATG
GGTCACGATGAAATGGCGGAAAATGATGGCGACATGCGGCGGGAAGGTTCGGAACCCATGGATCTGGGCCTGGACAACAA
CCAGTCGGGCAGCAACCATGAGGTGGCCAACTCCGATGCCGAGGAGAACTACTCGGAGGATGAGGGAGTGCACAACACAT
AGGAGGAGCAAGAGACTCCAGCGAGGGAACCACGAATATGAACATGAACATGAACATAAACAAATGTATACCGATTACCC
ATGGAACATATGTAACGAGTAGCCTTATCCTCATGTATACCAGTTTATGTGTACGATACGATACAATACGATAGTGAAAC
CTAGGACTAAAATCATATTTGTGCCGCTGCCAGAGCTGGCCTAGTAGAATTCTATGTTGTGCTTTTAAAACTACTACTAC
TACTACTACAGATATATGTAGTATACCTCTATATATAGATATATCGCTATACACATGTATATTTATAATTTATATACACA
AGTACCTGCTGTGTATACAAGTCGATGAGGAGAAGAAATGAAAAGAGCCCCAGACAACCCATCCTGCATGAAAAAGAAAA
CGTAATGGTAGTCTTAGAGTACTAAGTTAGATTTCACATTGAAAGAGATGCCTGTAAATACATTAAAAGAAAAACTTGAA
TATGTTAGGCCAACAGCAGCCCCCAAACGATCCGTCGTAATTAGTATTGTACCAGACGCCAGCAGATAATTCAGATGTGC
CATGCATGCCACAGCCTTCCAGTTCCAAGTCTAGCCAGTCTATACCAGTGCTTACCATATCTCAGGAACACTTGCGGACA
AATCCGAACAACTCAACCGAACTACCTCAGCCAGCGAAAGAGCTGAATCCCCGAAACGAACCTCAGACTTCCATGAGTTG
TGACTGGTCCTGCACTCCATCTTCATGAAACTTGCCAATTTTCAGCAGCAGATATCTGCTCTTAGACTTAGAATCCTATC
GCGAGGGGATCAGCAAACAAGAAATTTAATGTTTATACAACTAACATACGGTATACAGTGCACGCTCGGTATACGTATTT
ACACTTAAATATACAAAACATATGAATGCCTGTACTTATTTGTCAGAGAATTGAATACCTCAGCATACTCAGCATTCGGT
CGTCAGCACTCGAAGGTGGAACCCCCTTAATGATATCCAGTGCGAATCATAAGCATATACTTATACTTAAACTAGGCTAG
TTAGTTTATGTGGCAGCACTGCAAGCAAGACATAGATAGATGTAACTACTTGTTTCCTGAATGTATGTATTTAGTTGGAA
TATGCCTCAGTTATTCTAGGTTTATGGTTAGCTTCAATCGGAGATGAGCATAGACTCTACAAGAGTCGATACAACTTGCC
TTATGACCAACATATGTGTTAATTTAGTAATTTTCTACCTCAATTAATTTAAATGTATTTTACTTGGATATTTATTTGTA
AGTCCTTAACTGCACTCTGTAATATGTAACTTATTTCACTGGCATGCGTGTTTTTAAAAATCTTACTTAAGAGCCACCTA
ACAGCATAGCGAGATATAAATAAAAAAAAATTAAGAACAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0332558
5164
FBtr0332560
4888
FBtr0332561
4269
FBtr0332562
4490
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0304815
894
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0304816
904
FBpp0304818
894
FBpp0304819
899
FBpp0304820
894
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG43860-RB
ab-RB
Secondary FlyBase IDs
    References (0)