Open Close
General Information
Symbol
Dmel\nkd-RC
Species
D. melanogaster
Annotation Symbol
CG11614-RC
FlyBase ID
FBtr0332650
Feature type
Associated gene
Evidence Rank
Length (nt)
4685
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 72 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTCAGATTGTTTTCGTCCGTTGATTCGAAAAGACGTGTGAACTGAGACTCGGAGATACAGCGGAAAGGATCTAGAAGATA
        CGCGTAGTTTGGCCCACCAAAACAACTACTGACCGAACGGATTGTTGTGGCCCAGTGAAGTTATCGTTGAAATTGGAAAT
        TGATCAAATGAATAAATGTATCCGCGAGATACGCCCAGTGAAGTTTTAATTTTCTAGCCGGAGAGAAAAATCAAGTGTGA
        AAAGCAAAAAGGAAAAACGAAAAACGAAAAACCGCCCCCACAACAATAACAAAAACAACCGGTACGCCACCCCCCGAAAA
        ATTGACGTCGCCGTCGCCCTCGTCGCAATCGTTTGGAAATAAATCGTGTTTTTGCATTTGTTGTTTTTTGTTGTTTATAC
        GCCAAGTTATTTACGTCGTCGCAAAGCAAAAAGAAAAAATTGAATAAATAACAACAAAACGGCTGGCGAAAAACAAATCG
        AGTCGGCGAAAATGTTTTACAATTAAAATTACGCGCGCAGCGGGCACAAAGGTACCAATATACACGAGTGCGAGCGCGAG
        TACGAGTATCTGCAAGATACACACACGTAGATCAAATAAAGCAGCGCAATATGCGCAAATTAAACTAAAATGCAGCACAT
        CAGAGCTGTAAAAACTTTTACGACAGCGACTACGACTGGTAACTTGCCACCCGCACAGTCGAAAATAATACCAGATACAA
        ATTAAGGTCGCCCAGCGGCAGCGCATAAACACGGTGGAACGGGAAGTGGCTGTGGAAGTGGAAGCGGAGGATTCTCTCGC
        CTCCTACCTGGAGTATATTAGTCTCAGTCCTTAGATCCTTACACAAAAGGATAGCCAGCCAGGGAGCGCAGAACGCACAC
        ACAAGGGCCGTAAAACATTTTGGGCTGCTGCTATACTGCAGGTCTCCTCCTCTCAGGACTCGTAAATTTCCAGCCCAACC
        ACCACCACCGCCGCCCGAAAAACGGAAAATAGAAACACCGAAAAATCCAAGACACCGCCAAGTAACTGCATCCTCAACCC
        GCTTATATATAGAACTATATAGGTACATATATCCGGGCAGCGATGGCGGGTAACATTGTCAAATGGTGGAAGCATAAAAT
        TCTCGGCGGCTACAAACAATTCTCAGTCCAGGAATGCACCACAGACTCCGAGGAGCTGATGTACCACCAGGTGCGGGCCT
        CCTCCTCCTGCAGCGCCCCGCCCGATTTGCTGCTGGTCAGCGAACGTGACAATAATATCCAACTGCGATCGCCGGTAGTG
        AACATAATCACCACGCCGCCGGGCAATGCGTCTGGTGCGGGAAGTAAGCAGCAGTCTCATCACCAGACGAACCACCACTC
        CTCGGGCAGGAGTCATCCCGGGCACACGGCACATCCGCAGGATGTGAGCAGCGGCGGCAGCCATAGCAAGCATCTGCGCA
        TCAGCAGCACTTCCAATGGCAAGCACGGCAAATACTCAAATATGCAGCAGCAACTGCCGCAGGATGAGGATGTGGTGGAT
        GCGGCTGCCACGATGCAGCAGCAGCAGCACACTGGCCACGCCCACTCGCGCCACCTGCACCACCACAAGGAGGAGCGCAT
        CCGACTGGAGGAATTCACCTGCGACGTGTCCGTGGAGGGCGGCAAGTCATCGCAGCCGCTGCAGTTCTCGTTCACGTTCT
        ACGACCTGGACGGGCATCACGGCAAGATAACAAAGGACGACATCGTGGGCATTGTGTACACCATATACGAGTCCATTGGC
        AAGTCGGTGGTGGTGCCCCACTGCGGCAGCAAGACAATCAACGTGCGCCTCACCGTCAGTCCCGAGGGCAAATCGAAATC
        GCAGCCGGTGGTGCCCGTTCCGGTGGCAGCCGGATTCAGCAGCAGCCACGCCAGCAAACTGAAGAAGTTGCCCACGGGTC
        TGGCGGCCATGTCGAAACCCCTGGCCGGCGGAGGAGTGGGATCCGGCGGAGCGTCGGCGCTAACGACATCCGCCGGCAAC
        CGCCGCCAGCATCGCTATCGACCACGCAAACTGATTAAGTCCGATGACGAGGACGATGACAGCAACAGCGAAAAGGAGAA
        GGACGCCGCCCACGCCCCTGCCGCCGACCAGCCCAGCGGAAGTGGAACAAAGGCGACTGGGAAGAGCCATCACCACCAGT
        CGCAGTCCGCCAGGTATCACCAGAAGAACAATTCCCGGGCGGAGCAGTGCTGCACGGAACAGAATACGCCCGACAATGGC
        CACAATACCTACGAGAATATGCTGAATCTCAAGTGCTGCAAGCCGGAGGTGGACCAGGTGGACTGTCCCTCGCACCGACA
        GCACCACCAGAGCCACCCGAACCATCAAATGCGCCAGCAGGACATCTACATGAAGCAGGCCACCCAGCGGGTCAAGATGT
        TGCGAAGGGCGCGCAAACAAAAGGTAGGCACAAGAAAACCCCAAGCCAATGTGAGTCCCATACGGCAACCGGCAGCACAA
        CAACAACCACAACAACAGCAACGCCAACGCTGCAATACGGGCTCGAAAATACCCACGTTAATTACCAACCACAGTCCGGT
        CGCCCAGCAGTCGCCGCTCAGCTGCAGTCCACCCACGGCGGAGCCCACCACCCCCAGCATTCCAGCAGCTCCGCCGGCCA
        TCGAGGTCAACGGTCAGCAGCACCACCCCACTCATCCCACTCATCCCAGCCACCACAACCACCACGAGCATCCCCAACCG
        CACATACCTATCTACCATCAGCAGTTGGCCATTAATCCGGCCGTTCTGGCCGCCCAGCAGACGCACAACACGGCCCACAA
        CAAGCTGAATCTGTGTGGCTACGACTCCTTTCTGCACGCCACTATCTGTGGGGGCGGTGCAGCCGCCCACTCGCCCCCGG
        CCACGCCCAGTAATGTGGCGACCGTTCAGCCGATACCCAAGAAGAGCCAGAAGAACCTGCTGCAAGGATACCAGCGTTTG
        GAGCAGTCGCAGCAGCAGCAGCAACAGCAGCGGAGCAGCAAGGACTACAAGAACTATGGCAACCTCATCTATGCCAAGCT
        GAGTGAGCAGCTGCAGCAGAAGGATCGGGAGCAGAGGCGACAGCGGCACAAGCAGCAGCAACACCAGATGCTGCAGGATC
        AGCCCAAGGATGCGAGTCGGTCGGAGCAGCGACCACCGACATCAAACTCCAGTTCGGCTGGCTCCAAGATCTACGGCGAT
        GCCGTCGAGTGCGCCCATCTACTGGCCAGCGAGGAGGAGGACCTACCCCCCAGTCCGCAGCTGACCAGTACGCCCAGCAA
        AGTGGTCAGCACGGACACCCTCATCGATCTCAACGACGATGTGGGCGAGGCTGTGGCCGAGGCAGTCACAGAAGGAGGCA
        AGCAGTCGTTGGAGGCTGAGGAATCTGGCCAGCAGGTGGAGGTGGAACTGGACACCAGCGCCTCCAGCTCCATGATACAC
        CGCTATGTGCACGAGCACATCCACCACCACTATCACCACTTCAAGGAGCAGCAGGATGTCTAGGCTAATCGGGGAATCAC
        ACTATAAACTATTTGAATGTTGCTTATGTTTCAGTCTATTGATTAATGTAGCGCGAATTGTAATTTAAAGTAAGCCTTCA
        TCAACTAAAACGAGAAAATATTCGAAAAACGATATTAGGGCCAGAAACAGTGGGGTTGGTTAAGTGAGTTTGGAGTTTGG
        TTAACCAAAGACAAATTGAGAACGATTGCTGACAAAAATCAATTGATAGAAATGCTAGATACTAAATAAAATAACTGATT
        ATTATTCTTTGATTTTGTAAAACCAATATGTAAATTAGGATAAATATTAAACCTAACACAGTGAAGTTAAGCTAGGTTCC
        TGAATAGGTAAAGAGGTTAACCAATTTCAAACTCGCATCTCCAATTTCTCTCAAGGAAAATCTTTAGAACCAAATTCGAA
        CTCAATGAAGATTTAGCCCACTGTGAGATCCACTGATCCCAGCATATACATACATACATACATACACATAGCCTCTATAG
        CTTACGCAGAATTCGAAAGAAAACAAAAATCATGCGCCTTTTGCCTTAGCAACAATCGAATCGCCGCTTCGCTATGCTAC
        ATGTTGCAGAAACACATATCACTATCAGAAACAACATGTTGCCAAGAGCATTTTGTGTTGCTGAGCGTGTACGTGTAAAC
        TAATGGGAGAAAAACTATTGTTTAGTGCAAATTATTAAAACAAATTGTTGTCTATGATATAAAGTTTTATGCGCCGCTTT
        TTACGTGTTTAGACAGAGAGCAACAGATGATTGTAGTGGAACTATGGCCGCCAGTTTAAGTTAACTACCGATATGGATCA
        TGTATATTTATGTTATCTAAGCCAATTAATTTAAATACTATTCTTAGTTTCTAACACTAACCCCAAACAAGACAAGAAAC
        AATGCAACTAAGTACTAAACCACAACGACCACCAACACAAATCGTAGTTCAATTATTATTTTAAAACTTGTTTTTAATTA
        CATCATCTGTCAAACAATCGAGTTACCAATCCAATCAATCAAACAAACAAAAGAAGCACAAAAACAAAATGCATTTAACT
        CTTATTTACATAAAAAAGACTGATTTCCAATTAAACAATATATTAATTAATTGCATATGAATAAAGGTATATATAAATAT
        ATATAGACAATTTATGAGAAATACTAAATAAATTATTGAATTGCT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075039
        5051
        FBtr0332649
        4674
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0304896
        806
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0074806
        928
        FBpp0304895
        553
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        nkd-RC
        Secondary FlyBase IDs
          References (0)