Open Close
General Information
Symbol
Dmel\miple2-RD
Species
D. melanogaster
Annotation Symbol
CG18321-RD
FlyBase ID
FBtr0332836
Feature type
Associated gene
Evidence Rank
Length (nt)
1147
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTTTGCCCACAGCTCTGAATGCGAGCGTAACGATCGCAAGCCGCCTGTCTTACAGTGAAGTGCATTTTCTCAAGCCG
          CTTCCTTGATTTGTATTTGGTTGGACAACAGCCTATAACTTGAACCCGTCTTTAATGCCCGTATCTCTGTGAGAGTTTCC
          GAAATAGTTATGAATCTTATACTGGCTTTAACCACGGCTCTGCACCTAGTTTTGGTGGTATTGGCGCACAATCCGCTATC
          AACTCGTGGCGAAAGCCTTTCTGATGGCATACGTCTGGTCATGGAAAAGAGGTCGGGCGATGTGGTACACATTCGTCCAG
          CTCGGGGCACACTGGAGGCCGAAACAGTCGCATCCACAACAAATAGTGACACCCACCGCACCAGGAACAATCGTAAGCCG
          AACAAGCCTCAAGAGCACTCTCAGCAGGTTGGGGCCCACAAGTCGGGATCTAGAAAACTAGTGGTTGCGGAAAATGGCGG
          GGCACTGTCATCACAACTACCACAACCAAATCACAAGCAAGGCCACAAGAACACTGATAAGCAACAACGAGGAGGGGGAT
          CCAAGCAGCAGCGAGGACATAGCCAACATCATGGAGGAAATAGGAAAGGGCCTAAGGCAGCGACTCCAGAGAATGGATCG
          ACTTGCCGATACGCAAAGAGCGCTTGGTCCAATTGTGATCACAAGACCAACATGCGTTCACGAGTCCTGTCCCTAAGGAA
          AGGAGAGCAAAACTGCTTGCCCACGCGGACCATACAAAAGAAGTGCAAGAAAGGTGCGCGCGGCTGCCGCTATGAAAAGG
          GTGAATGGTCTCAATGCGTCGGAGGACAAATAACCAGAGAGGATAAGTTGGAACCAGAGGCAACTGGCGGTAGTGATCAA
          AACTGCAATCCTGTGCGTACCGTCAGCAAGAAGTGTAAAGCAAATGGCAATTCCAGTGGAGGAAAACAACACGGCCAGAG
          TCGTCGAACAAAAGAGCAAAAGCAAAAGGATAAGGGAGCCAGTCACATTTCGTCTTGATAATGAAAATTATTTATTTTAT
          ACGTATACGGAAGCAACATTTTTAATATTAAATAAGCGATTTTTAAATGCTAGCCCGTACGGACTACTTGAACAACAATA
          AAGAATTGGCCTTCTTAGGGCTAAATG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0072506
          1138
          FBtr0332837
          1144
          FBtr0332838
          1031
          FBtr0332839
          1292
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0305059
          282
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0072406
          279
          FBpp0305060
          281
          FBpp0305061
          279
          FBpp0305062
          279
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          miple2-RD
          Secondary FlyBase IDs
            References (0)