Open Close
General Information
Symbol
Dmel\miple2-RG
Species
D. melanogaster
Annotation Symbol
CG18321-RG
FlyBase ID
FBtr0332839
Feature type
Associated gene
Evidence Rank
Length (nt)
1292
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 6 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGTCAAAAAGGAAAACGGTAAACGGCATGCATAGCTTTGCCTCCGCACTCTCTAATCTCTAGGGTCGGACGTTATGACCT
        GTCCTGCTTTGATAAATCTTTTCTATATTTCGTTTATTTCGCATACTTCCCTACTTATTTCAAATGCACTAATGCGAAAA
        ACATTATTTTTTCAAATCAAACGGTCAAGTGTGCTTCTAATGAAATCTCCGAAAAGGTCTATACTCCTCATACATTTCTG
        CAGTCGGCAAAAAAGGAGGCACATACTCGTAGAAATTTTTCATCGCTGTGTATATGGATTTGTAAATGGTTTCCGAAATA
        GTTATGAATCTTATACTGGCTTTAACCACGGCTCTGCACCTAGTTTTGGTGGTATTGGCGCACAATCCGCTATCAACTCG
        TGGCGAAAGCCTTTCTGATGGCATACGTCTGGTCATGGAAAAGAGGTCGGGCGATGTGGTACACATTCGTCCAGCTCGGG
        GCACACTGGAGGCCGAAACAGTCGCATCCACAACAAATAGTGACACCCACCGCACCAGGAACAATCGTAAGCCGAACAAG
        CCTCAAGAGCACTCTCAGCAGGTTGGGGCCCACAAGTCGGGATCTAGAAAACTAGTGGTTGCGGAAAATGGCGGGGCACT
        GTCATCACAACTACCACAACCAAATCACAAGCAAGGCCACAAGAACACTGATAAGCAACAACGAGGAGGGGGATCCAAGC
        AGCAGCGAGGACATAGCCAACATCATGGAGGAAATAGGAAAGGGCCTAAGGCAGCGACTCCAGAGAATGGATCGACTTGC
        CGATACGCAAAGAGCGCTTGGTCCAATTGTGATCACAAGACCAACATGCGTTCACGAGTCCTGTCCCTAAGGAAAGGAGA
        GCAAAACTGCTTGCCCACGCGGACCATACAAAAGAAGTGCAAGAAAGGCTGCCGCTATGAAAAGGGTGAATGGTCTCAAT
        GCGTCGGAGGACAAATAACCAGAGAGGATAAGTTGGAACCAGAGGCAACTGGCGGTAGTGATCAAAACTGCAATCCTGTG
        CGTACCGTCAGCAAGAAGTGTAAAGCAAATGGCAATTCCAGTGGAGGAAAACAACACGGCCAGAGTCGTCGAACAAAAGA
        GCAAAAGCAAAAGGATAAGGGAGCCAGTCACATTTCGTCTTGATAATGAAAATTATTTATTTTATACGTATACGGAAGCA
        ACATTTTTAATATTAAATAAGCGATTTTTAAATGCTAGCCCGTACGGACTACTTGAACAACAATAAAGAATTGGCCTTCT
        TAGGGCTAAATG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0072506
        1138
        FBtr0332836
        1147
        FBtr0332837
        1144
        FBtr0332838
        1031
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305062
        279
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0072406
        279
        FBpp0305059
        282
        FBpp0305060
        281
        FBpp0305061
        279
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        miple2-RG
        Secondary FlyBase IDs
          References (0)