Open Close
General Information
Symbol
Dmel\stwl-RB
Species
D. melanogaster
Annotation Symbol
CG3836-RB
FlyBase ID
FBtr0333041
Feature type
Associated gene
Evidence Rank
Length (nt)
3429
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 10 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CCAAACTTTTCGAGCAGTACAATATAAGTTGGCTCTTTTTCATTTGAGAACTGAAAAAATATTGCCAATGATGGGGGACT
          TCTTATTCGAGAATTCTTGCTTGGAAAAATGCAAGCGACGCTGGCGTCAGCTGCGAAATGACTATACCCGCTGGTGCAAC
          GCCGACGCCAACCGGCGACGAAATGGCCAGCGTCGTTTGGCTTATCCGCTGGCCGATGAGCTGCGCTTTTTGGACCGCCA
          TCTAAACATAGCTGACGACATGGCTGCCGACGATGACCGCAGCGTATCATCGGACAAGGACAGGGATAACAATAGAGACA
          GCGAGGGCGTGGATCATCATGCTCAGGCGTCATTAAAAGAACGCGCATCATCGACAAGCAAGTTAGTTAAGGAGGTCAAG
          CTGGCAAGTCAAGTTCGTAAGGAAAAATCGTCCCAAGACAAGAGAGAAAATTGGGAAAATCCTGGAGATAAACAGCGATC
          TAGGAAGAAAAGTGCTGAAGAGAAGCTGAATGATTTGGAGGAATCGGACGAACCAGAGAAGGTTCCTGAACTCGATAGTT
          TTCTGCAGTCTGATAATGAAGACGACGAGTGCATGGACGAGGAGCACCTAGAAGATCTGGAAGGTTTCGATTTTGACTTG
          GAACAATCGAATCAGGAAAAGGAGTTAACGCCGGAGAAGTCTCTAGAGAAGAATAACACCGACTCAACTGTTAGCCAGCC
          GGAGTTCTTTGTCAAGCAAACCAGAGATCCTCGTTTGCTAATTATTGGCAGAAAGAATTCGACGTCTTCGTTTGCTGAAT
          CCAAGGCTTCAAAATCTATTTCCGGGGATCCTCTGGAAACGGCTATGGAAGATAGTGGCGATGAATATGGTAGGGATGGT
          GAAAAACGCGTCACAGGCAGCGACACTACTTCTCCAACCCGACGTCCACGTCGCGCAGCCCGTGCATCAATAAGTTTCGC
          TGGCATAAGGGATTTACCGATCCAGAAACCAGGCCAAGCACAACGAATGACGCGATTGCAGCGCAGGAAATCTATGAGTT
          TAGCGGCTGTACACAGTGTAAGGAGCTCCACATCGCCTGTGAAAATGACTCCAGTCCCCAGGTCTCAGCCGATCAACAAG
          CCGCCATCCGGGCCAGTCCAGATCACGAAAATCAGTCATCGGGATGACATCTTCCCGAGACCTGCGGTGCCATCTGGAGT
          TGTGAATATAAATCAAAACCAACTCAAGACTCAACAACAGCAGAAGACGCTGATCTTTCCGACGACCGATGAAGCGATCG
          CTAACCCGCAGGGATCTGGTCCACCACAAAGGAGGTCCGTGGGTAGGCCGCCCAAGAAGCTACCTATGGTGCAGCGAATA
          GTTGCGCCGGAAACGCAGACCAAGCCACAGTCGCCCATAAACACCAAAGTCCTGACCATTGGCAAGCCCACCAGCTCCGT
          CGCGAGTGGTAACATAAATAATATTGCTATCAAAAGCAACGTCGTTACTAGCATAAGCAGCAGCACCGCTACTACTAATA
          CCATTACCAAAGGTACCAGTAACAACAGCATCAAAACTACTGAAAACGTTAATGTAATAAGCTACAGTCCGAATTCATCT
          AGCACCAGCAGCAGCAGCAAGGCCACCACTGGTGCCTCTGGTGCGGTGATAACTAATATACCCACAACCACCACAGCTGG
          AACATCCGTTCCGGTCGGAAAGAGTATAACCCAATTGAAAATGACTGAGCGAGGCACTCAAACCGGAGTCCAGAATCCTT
          TCTCCGATAATTACTTTCTCGAAATGATCAAGCCCCAGATGCAGGAAATGAACCCCCGTCAGAAGATGCACTTTAAGAAG
          AAAGTATTCCAAGCGCTGATGGAAACCTTTGATGATGCTACCGATTTCCCAACGTCTAAAGAACTGCAGCATTTTAATAT
          AAACACTCCTTCAGGATTTGAGCACATTACAGATCCGGAACTTCGATTGGTCAGGGAGCTAGTCAGCATGGTGAGCGCGG
          CTAAGGTTACCCTAATTAGACCGCCAGGAGAAGCTACAGCTATAGCTACAGCTTCCCGCAGTGGAATTGCTCCTGAGGTA
          CAGCGAGGACCCCGAACAAATATGACACGCCAAGTCATTCAGAGGGTATACAAGCCAGGCACTGGACAAGAGATCGCCCC
          CACCAGCCCGGCGGGTGGACTAGATAAGAGGTTGTTCAGGTTAGCGGCTATGGGTGGTAAACCGAATGGCAACTTGAGTG
          CCACTCAGGAAATTTTGCGCAAGGATAGTGTTGACAGTAACCATAGTGTGGTCAAGGTGGCCAACCACGCCCCAACAGGC
          AGTCCCAAAGGAGCTGCTGTAGTGGCTGCTATAAGGCCGCAGGGTTCATTGATCAACAGTTTCTTTGGACAAGGCAATGG
          ACCGACGACGGCCAAGGGAGCTGCCTCCGAGAATATCCGCGCCATGTCCAGGAGGTATTCCGTGTGCGGTAGCAGCAATC
          CACCCAATGCCCAAAACGCTAGCCAAGGTTCCGCCAATGGCAGCACCATAAACTCCAATGCTAGCGCTATGGAAGCGTCT
          ATGCTTAAGCGGCGATTGATAGCAGCTGGGCATGGAATGGTGCCACCTACCCAACGCCCTCGGTATTCTGCCGTAGGTGC
          TAGTCAAATGACCACTGCATCGCAAGGCAGCAGTTTACTAGTGAGGAAGTCTGTGGGCTGCGTTCCTGCTTACCAAAAGC
          AAATCTCACCCACTGGCGGTGCCTCCCTGCTTCAGAAAACTCCGCAGATTGCCAGTGTGCAAGGATCTGCCTTCAATGAC
          TTTGCCCAGCCCAAGCCCGCTGCAACGGCCTCTGTAAACGGCGAAGAAAGTTCGCCTACCTCGGCGCTGAAGCGCAGCTT
          GGTGGTGGCTAATACCAAAACCTCCTTTCAGGACCTTCTTCAGCAGGCCAGTCAGACGGTGCAGAGAAATAAAATTGAAT
          CCTCGGAGACAGCAGCCACTATTGCTGCGGATGATTTTTCGCTGGACAACCTTAAGCGAGAGCCAGTGGATCCCGCGGAG
          GATCACAATGACATACTCGGTGTTTAAGACCAGGCCAAAGAAATTTCCGAGTATTGATTAAAGAGTAAAGAATTAAGACA
          GATTCATTAAATCGTAAATAACACGTTGAAAAATTGTTAAGCTATCTAATGCACTTATAATGTTGCGTTAAACATTTTTT
          ATAGTTCCCTATAATTTTAAGAATTTCGAATTTTTTTTTTTTGGAAAAAGTTTTTAACTTTTTCTATTTTGTTCATAATT
          TTTTAGACGATAGAAAACCGACAGTTTTGTTCAAAATTTGCACAAGAAAAATGATTAATGAGAAATCGAATCTTAACTTT
          ATTTCACATTTTCTAGTTATATATATCGAATAAAAATTGCCCTTATAAGTTAAACAAAAAGGACAACTG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0075728
          3653
          FBtr0333042
          4233
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0305255
          999
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0075471
          1037
          FBpp0305256
          1037
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          stwl-RB
          Secondary FlyBase IDs
            References (0)