Open Close
General Information
Symbol
Dmel\ImpE1-RC
Species
D. melanogaster
Annotation Symbol
CG32356-RC
FlyBase ID
FBtr0333057
Feature type
Associated gene
Evidence Rank
Length (nt)
6099
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 44 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CTCTTCAGTTCGTTGCTGACCATCGTTACGTGCGGACGTGCCCAGCTCAGCTCATCTTCGTGTGATGTGGCTGCACTTTG
          CACACTAAACTTAAGATCTGAGCCCAAAACGTTTTCCAAGCTGCAAAAATATAACAAAAGTGCCGCGACGCGTGTGACAA
          ACGAAAATCGAGTAAAACGTTCAGAGTTTAAGTCAAGCCTCCCCTCACCACCACCACACTGACTCCTTTCCACAGCGAAA
          AACATATATTTACGACTGCAACGAGAGGAATACCAGCTACAGGAAAATAACCCAAGAAAAGCGGCTGAAAAATCGAAAAA
          ACCAAAAGAAAACACACAAAAGGAGGGAAAAGCGAGAAAAGCCTTCCCAGGGAGATCCAAAGCAGCTTCTTTGGAGATTC
          AGAAGCGGCAATGACGGCGACTGCGAGGCAGTCGGCAACATCGAGAAAGCAACCTGCGATCGCAATGCTCAATGGAAACG
          CTTTTACGGTTAAGCGGCTCTTAGCGCTGCTGATCATCTTCACAGTGGTGGACGCGAGTCGATCCCTGGAGCTGGGCGAC
          AAGTGCCAGCATGACATGGACTGCACGGATTTCATCAAGGGCAGCAGCTGCTCCGCCCTCGGATACTGCGAGTGCGCCCC
          CTACTTCGTCCAGTTGGATTCCAAGCGCTGTTTGTCATCCCAGCTCCTTGGCGGCGACTGCCAGCTGAGCGAGCAGTGCT
          CCATGAAGGTGGCCAATAGCAGTTGTCTGGAGGGTGCATGCCGCTGCGTCGAGGGATTCCTGCAGTTCCGCAAGCACACC
          TGTCTGGGACCTGCCCATCCTGGTGCCGTTTGCTACAGCCACGCCCACTGTCAAATGTTCGACACCCGCACCCACTGTGA
          CTTCCTCATCCCGAATCTCTTCGGACGCTGCCAGTGCACAAGTCCAGCCAAAATGGTGGGTGGTCTGTGTGTGGCCCCGG
          CGGCGGATCAGGAGGATCAGAAGCAGGAACAGGCCGTGGAGAAGGTAGAGCAGCCAGCTAGCAGTACCACTACCACGACG
          ACAACAACAACCACTCCTAGGCCCACAACTAGAACCACGAGTAGAACAACGACGACCACCACTGCAGCACCACCAACAAC
          CACCAGAAGAACAACAACGACCACAACTACGACAACTCCAGCGCCCATTCTCCTAGAAGATGAGCTGCCCGCCAGCGTGG
          AGGAGCAATCGCTGGAGGAAGACGATGGTGAGACCACCAAGCTGAGACCCGAGGTCGTTGAGGTTGATAATGGTGAAAAA
          TTGGAGGCTGTGGACCTGGCTCATGAGGAAACCGAACTGACACAGCAGCAAAATCAATTAGATGAGCAGCAACATCAGGA
          GGAGGAACAGAAACATCAAGAGGAGGAACAACATAGGATTGAGCAGCAGCAGAACCAAGAGGAGGAGCAGCAGCAGCAGC
          AGCATCAGCAGCAGGTCATAGACCAAGCAAGCGACGCAGAGCTTCCTCAATCCTCCCAAGATGCCACCACTGGAGTCCAA
          CAGCTGCTCACACCTGCTGATGTGCCAACCGAGGATGCCATTAATGCGGAACAGGAAACTGAGGCTGGACCCACTGAAGA
          TTACCCATACAAGATCGATGAGGAGTACACAGAGGAGCACAATGACAAGCCAGAAGCTCCAGAACTGACAGTGGATCAAC
          CTGAGCACGAAGAATCCCCAGTAGCCACTGAAATCGTGCCTATCGAAGCGGATGAGGAGGCTGCTGAGGCCTCGGGTGGT
          CAAGAGATTGCCTCATCGCCCATCGACGATACCATGAAATTCGATTATGAAACATCAGTGGATGATGTTGAGCCAGCCAA
          GCCAGAAGATGAAAAGGAGACGGAGGCAGTACACCAAGCGACTAATGAGGGGGTGGTGCCCATTGATACCGAAAGCGAGA
          CTGATGCAGAGACTAGCACCGAGCCCCAGATCCAGACGCAGCTGCTGCAGGAGGATGGAGAGCCAGAGACATCGCAGACT
          GTGGCCGATGAAGAACTGATCCCGGTTAATGAAGGTGAAACCGAAAGTGTGACGAAGGCAGCCGACGAGACCGAGGAGAT
          ACCGGAGGAGGAAACACCTGAGGATCTGGCTTCGGGAGATCATGAGCTGGATGTTGCTGCAGCCAGCCACGATGATGAGG
          TGGAGACGCCCAAGCAGGAGGAGCCAACAGAAGCGTTGAAGATCGAACAGCCAGCCCAGGTGGAGAGTGAAAGCCAAAAC
          GTCGACGAGGTGGGAAAACCAGAGGAGCCACAGGCCGAAATGGAAATAGAAAAAGAAAAAGAAGAAACGGCAGCGACCGA
          AGCCGCAGAAGTGGAGCTGCCGGCCACAGAAGCCAAACCAGATATGGAATCCGAGATCGATCAGGTGGAACAAAGCGCCG
          ACATCAAGCCGACAAGTGGCGAAGATGATTTAAATGAAGCCAATCAATTAAATCAAGACCAAGTCACCGAGCCAGCCGCT
          CTTGAACAGGAGGAGATCGAAGAAAAAGAGCCCGAGCAGGTGGTGGATATGCATGAAGATGCAGATGAAGCCACAACGGA
          GAAACCAGTCCAAGATCACGACCAGGAGGAGGTGGAGGCAATCACCGAAGCGGAGCACGGACAATTGACATACCCAACAA
          ATGATGATGAATTGGCGCCAGTGGAAATAGAACCAGAGCTGACCACAGAGGAACCAGAAATCGCTGAGAACACCACCGAG
          CTGCCCGAGCAACAGCAACAGCAGCAGGATGAGGAGGAGATTGAAGAGGCGGCACTTGCACATGAGGAGCAGGTGCAGCA
          GGTGGAGCCCGAGGAAAATGCAAATGCAATTAAGACGCCCGAAGTGTCGGAAGCAATTGCAGAGCCCCAGGCGGATCTAG
          AAACCCCGTCAGCCACCGAGAAGGAGATCGAACCACAGACAGCGGACCATGTTGAGGAGGAGCCAGTGGCGATAACCGAG
          CGCATTCAAGAGGCAGAGCCAGAGCCAGAAATTGAGCCCACTAATGACGAGGTGTCGCAGGTGGATGCGGACCAGGCCGA
          GCCAGAGCTGCCAATTAAGAGCGATGCCGACATCGCGGAGGAAGCCGCCGAGGAACCTGCTCAGACGGAGGTGGCTCCCG
          AAGTGGAAACGGAAACCGAGGCCAGTGAAAGTGCTCAGACATCTCCAGAGATTAGCGTAGAGCAAGATGAAGTTGCGATC
          GATAAAAACGAGAATGACAACATTATCCAGGGAGCCGAACCCAATGAAGAGGACGAACTTATCCCGGAACCACAACCAAT
          GCCAGAAGAGGAGGAATTGCCAGTTCAACAGGAAGCATCAGCTGTTCCGGAGGATCATAAGTTGACCAAGCCAGAAATGG
          ACTATACCAGCGTGGAGCATCTACAGGAACTTTCCCGGCCAGAAGAAACGACTGCTGCTATTGAAGCTGAAGAATCTGAC
          TCTCGCGAATCCACTCTGGCTCCAGAGGCTCCAGATGCACCTATTGCCATTGTGAGCGAGGAACGCGATCCCGAACATGA
          TCCTCAGAACTTCCATGAGAGCGAGAGCATTGCTGATATCCTCAGCGACTTGATGTTGGAGGCTGACAGCACTGTGCCTC
          CTGTTCCATTTGGTCAGCAACCCGCCCAAACGGTTCCCATGGTGGAGGCCAACTCGGAAAACGAGGAGGAACAAGCACAT
          GAAGCCATTTCGGATCTCCAGGCTGAAGCCGATGAGACCCAGGAACATGCCGAGCAAGTGCAACCGGTTAACGAGCCAGG
          AACTGCTATTCCCGAACTGTTTGCAGAGGCAGCTAAGGATGAAGAAGATGTCCCAGCTCTCCCAGAATCTGATGAATCGA
          AAACCGAACAACCAAGCGCTCTGGAGGTGGAGCAGCACATTGCCAGTGAAGCGGAGCAAACGCCAGTGGAAGATGAGCAC
          CAGTATGATGAAGAAGAGCACCAGCAGGATCAGGAGGAACATCAGCAGGATGAGGACGAGCCCCTTAAGGAAGTAGAAAC
          CGAATCCCTGCCAGAAGAAGCCACCACAGAAAAGTTCCAGGAGCCCGAGCCCGAAGAAGTTAACACTCCGTTGCCCGAGG
          AACTGCCCTTCGATCTTACAGATCACTCCGATGTGAACCGCTTCAATGAGCTGCAATCCGAAAGTCTAATTCTGGAATCC
          ACTACCAATATCGATGGTCTGCAGGAGCTGGACAACAACCATATTGAGGAAGAGGAGCCAGCAGCTCATGCCATTCCACA
          TGAGGAGGCCACACCCAATCCCGCTGACATTGTCGAGATCACCACACAAACCATGTTGGGCCTGGCCAGTCGTGTGACCC
          TTATGGAGCCCGCTGCTCCCGTCGTTACCACGCTAATGCCCCTAATGACCGCCGATGAACCCACGCCGGAACCCGTTTCT
          CCAGCAGCCATTCCTTCCGCCTCTCTGGCTGCCATCAAACCCGGTACGGAGTTGCGCAAGCGCGTGGATTTGGGTCTGGA
          AGCAGTTTCACTTGGATTGGCCTGCAGCAGTGATCGTCAGTGCCAGTTGGCTGATCCCCACACCGTGTGCAATAGACGAG
          GAGTCTGCGATTGTGCTGCCGGAGAAGAGGGATCACAGTGCAGCGCCGAGAGAACCGGATGCAGTCCGGGAACCTTCCAG
          TGCCGCTCGAGTGGCGTGTGCATCTCGTGGTTCTTTGTGTGCGACGGCCGCGCCGACTGCAATGACGCCTCCGACGAGGA
          GTGCACCCACAACGCCCGCCTCAACCAGACCTGCCCCACGGAATCCTTCCGCTGCCAGCGAAGCGGTCGCTGCATCTCGC
          GCGCTGCGCTGTGCGACGGACGACGGCAGTGTCCACATGGCGAGGACGAGCTGGGCTGCGATGGCAGCGTGAAGGGCGGC
          AACGCCTGTCCGGAACACACCTTCCGCTGCGGCAGCGGCGAGTGCCTGCCGGAGTACGAGTACTGTAACGCGATCGTGTC
          CTGCAAGGACGGCAGCGATGAGCCGCCGCATCTGTGTGGATCCCGCGCCCTCCCCAACCTCTTCATGCGCCTCATCGAGG
          CGGGCGGCCTGCTCGGCGGTGGTCGGCGGGAGGCGGACGCCTACTGTCCGCACCGCTGCAGCAACGGACTGTGCCGCTCC
          ACGGCCATCGTCTGCTCCGGACGGGATGGTTGCGGTGATGGCACCGACGAACAAACCTGCTCCGTGTGCCGCTGTCCCGC
          CCCGACTGCTGCCAGCCTGCCCGCATTCTTGGCCCGACAACGCCCCATGCCGCTGTGGTAGGCGACTGCGCCACCTGCAC
          CACTCACAGCATATGCACTCCAACCACTTGCGGTCACCATTTCGAAATCAACTGATTGATTGACCCGCTCCTGTCTTCCG
          AAACCTTCGAATCTATCGCTTTACCCAACCCAATATTCGAAAAGATTTTTGCCTAGCATTTAAGTGGATATTTAAAAATT
          ATTTATTTATTTATTATGACCTTAGCTGCGCCCTTGCCACGCCCAATTGCCACCTTGCTATCAAAGGGGGTTTTCCCAGA
          TTCCCTTTGAGCCAGTGATGTTTGTCAATTGAGCCACTGGGCACAACCCCAATCCACATATGACACCACACGCCACAAAG
          GACACACCACCACCCCACCCACACTTCGCCCCCATTTCGACTATTTATTCTACTCATCTAAACCATCAAAACTATTTATT
          TATACCCCCTCCCCCACAAACAGACACTGAAAAACACTCGAAATGAATTCTTCATTTAGCTTAGTTTTATGCAATTTTTT
          AATTTATTTAAATTATTGGCCAGGCAAACCAGTAACCGAAAAAAAAAAAAACGAAACAAAAACGAAAACGAAAACCATGA
          AATGATGCATTTTTATCGATTAATATTTTGTAAATAAGAGTAAACGTGTTCGATGTACATGATAAACGACAATGCCTATA
          ATGAAATGAAACATAGAGTATCCAACATAAACAATCCGATCATATCCCCTATATAGTTTATTATATGTACGTGCGTGTGA
          GAGACACTCACACACTTTTCTCACAGTCAAGACGCATCACAGTAAAACTAAAAAAAAAATTAAACAATAATAAAAAAATA
          TATTTTTAGAAAACTATTG
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0076606
          6043
          FBtr0076607
          919
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0305271
          1616
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0076333
          1616
          FBpp0076334
          146
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          ImpE1-RC
          Secondary FlyBase IDs
            References (0)