Open Close
General Information
Symbol
Dmel\tim-RN
Species
D. melanogaster
Annotation Symbol
CG3234-RN
FlyBase ID
FBtr0333254
Feature type
Associated gene
Evidence Rank
Length (nt)
3136
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      GCATTCAGCATTGTGCGTTCCAAATATAAAACAAAAATAATTTCATCAGTGTATATAACAGCACTGAAACTATAACACGA
      TCTATTCTGCAAAGAAACCCAAAAAGTGCTCAGAAAAGCTCAATTGCTTAGAAACATAAACAATCAGCTTTAATTGTTGA
      TTGCAATTCGGCTAAAACTAAAACAGTAAAATTGTCTGCGATAGAAAAAATTTAAATAATTGTTACAGATACCGCGCAAA
      TGGCTAAGAAGTACCTCAATGTTCGCAGTCGACAATGAGCAGAGTTAGGCAGCTCCACAATCACATCTGGAATAATCAGA
      ACTTTGATAAAGTGAAATCGGTTATGGACTGGTTACTAGCAACTCCGCAGTTGTACAGCGCGTTCTCCTCCTTGGGTTGC
      TTGGAGGGCGATACCTATGTGGTCAACCCGAATGCATTGGCCATTCTGGAGGAGATCAACTACAAGCTCACCTATGAGGA
      CCAAACACTGCGCACCTTTCGACGGGCCATTGGATTTGGCCAGAATGTGAGGTCAGACCTGATACCGCTGCTGGAGAATG
      CCAAGGATGATGCGGTCCTGGAGTCGGTCATCCGGATACTCGTCAATCTGACGGTGCCGGTGGAGTGCCTCTTCTCCGTG
      GACGTGATGTACCGCACGGATGTGGGTCGCCACACCATCTTCGAGCTGAACAAGCTGCTGTACACCAGCAAGGAAGCATT
      TACCGAGGCCAGGAGCACCAAGAGCGTGGTGGAGTACATGAAACACATACTGGAGTCGGACCCTAAGCTGTCGCCGCACA
      AATGCGATCAAATCAACAACTGTCTGCTGCTGCTGAGAAATATCCTGCACATTCCAGAGACGCATGCCCATTGCGTGATG
      CCCATGATGCAGTCGATGCCGCATGGCATCTCCATGCAGAACACGATCTTGTGGAATCTCTTCATCCAGAGCATCGACAA
      GTTACTCCTGTATCTGATGACCTGTCCGCAGAGAGCCTTCTGGGGAGTGACCATGGTGCAACTGATTGCTTTGATCTACA
      AGGATCAGCATGTGAGCACTCTGCAAAAACTACTTAGCCTCTGGTTCGAAGCCTCTCTGTCGGAGAGCTCTGAGGATAAT
      GAGAGTAATACCTCGCCCCCCAAACAGGGCAGTGGCGATTCCAGCCCCATGCTGACCTCTGATCCTACCTCTGATTCCTC
      GGACAATGGCAGCAATGGCCGTGGCATGGGCGGTGGCATGCGGGAAGGAACAGCGGCCACTTTGCAGGAGGTGAGCCGCA
      AGGGTCAGGAGTATCAGAACGCCATGGCCAGAGTGCCAGCGGATAAGCCCGATGGCTCCGAAGAGGCCAGCGATATGACG
      GGGAACGACAGCGAGCAGCCTGGATCGCCGGAGCAATCGCAGCCCGCCGGCGAGTCCATGGACGATGGAGATTACGAGGA
      CCAGAGACACAGGCAACTGAACGAGCATGGCGAGGAGGATGAAGATGAGGACGAAGTGGAGGAGGAAGAGTACCTACAAT
      TGGGCCCAGCCTCGGAGCCCCTAAACTTAACACAACAACCAGCTGACAAGGTCAACAACACTACCAACCCAACGTCCAGT
      GCGCCACAAGGCTGCCTGGGCAATGAGCCATTCAAGCCACCACCTCCTCTGCCAGTCAGAGCCTCCACCTCGGCACACGC
      TCAAATGCAGAAGTTCAACGAATCGTCCTACGCGTCCCACGTATCTGCGGTCAAATTGGGCCAAAAGTCCCCACATGCCG
      GCCAGCTCCAGCTGACCAAGGGCAAGTGTTGCCCACAGAAGCGGGAATGCCCCTCCTCGCAGTCGGAGCTATCGGATTGC
      GGTTATGGCACCCAGGTGGAAAATCAGGAATCCATTTCCACCTCCAGCAACGACGATGATGGGCCGCAGGGCAAGCCGCA
      GCACCAGAAGCCTCCGTGTAACACGAAGCCACGGAATAAACCACGGACGATTATGTCGCCAATGGACAAAAAGGAGCTTA
      GACGCAAAAAACTGGTCAAGCGCAGCAAAAGCAGCCTCATCAACATGAAGGGTCTGGTACAGCACACCCCCACCGATGAT
      GACATCTCCAATCTGCTGAAGGAATTCACCGTGGATTTCCTCCTCAAGGGTTACAGCTATCTGGTGGAGGAACTGCACAT
      GCAACTGCTTTCCAATGCGGTGCCCATTGACACATCGCACTTCTTCTGGCTGGTCACCTACTTCCTGAAGTTTGCCGCCC
      AACTGGAGCTGGATATGGAGCACATCGACACTATTCTCACCTACGATGTTTTGAGCTACTTGACCTATGAGGGTGTGTCC
      CTATGTGAGCAACTGGAACTGAATGCCCGACAGGAGGGCAGTGACCTGAAGCCCTATCTAAGGCGAATGCACTTGGTGGT
      GACGGCCATCCGGGAGTTCCTCCAGGCCATTGATACGTACAACAAAGTGACTCATCTGAACGAGGACGACAAAGCCCATT
      TGAGGCAGCTTCAGCTGCAGATTAGCGAAATGTCCGATCTGAGGTGCCTTTTTGTGCTTCTGCTGAGGCGTTTCAATCCC
      AGCATTCATTCCAAGCAGTATCTTCAGGATCTGGTGGTTACCAATCACATCCTCCTACTCATTCTGGACAGTTCGGCCAA
      ACTTGGTGGATGTCAAACCATTCGCCTGTCGGAGCACATAACACAGTTTGCCACGCTGGAGGTGATGCACTACTATGGCA
      TTCTGTTGGAGGACTTCAACAACAACGGAGAGTTTGTCAATGACTGCATCTTCACCATGATGCATCACATCGGTGGCGAT
      CTGGGCCAGATTGGGGTTCTATTTCAACCAATTATTTTGAAAACCTATTCAAGAATTTGGGAAGCGGACTATGAACTGTG
      CGATGACTGGTCTGATCTTATCGAGTATGTGATTCACAAGTTCATGAATACTCCTCCGAAGTCGCCACTCACCATTCCTA
      CAACTTCCTTGACGGAAATGACCAAGGAACACAACCAGGAGCATACCGTTTGGTAAGGATTTCAGAAGATTTCCTTGAAG
      CAATATATTTAATAAGGGTATAAGCAATATAATCTTTGATCTAAGATACAACTAACATAAGCAATAAACATAACATTTTT
      AACATTTGTGGACCAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0077567
      5073
      FBtr0333252
      5077
      FBtr0333253
      5641
      FBtr0333255
      3525
      FBtr0333256
      5404
      FBtr0333258
      5020
      FBtr0333259
      5214
      FBtr0445397
      5073
      FBtr0480508
      5931
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0305452
      890
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0077256
      1398
      FBpp0305450
      1397
      FBpp0305451
      1131
      FBpp0305453
      891
      FBpp0305454
      1398
      FBpp0305456
      1366
      FBpp0305457
      1099
      FBpp0401565
      1421
      FBpp0428305
      1365
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Based on cDNA(s) that result in premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      Downstream translation start supported by FBrf0092669 and FBrf0101975, and by comparative analysis across Drosophila species.

      Corresponds to tim-sc (FBrf0244295, FBrf0244296).

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      tim-RN
      Secondary FlyBase IDs
        References (0)