Open Close
General Information
Symbol
Dmel\tim-RS
Species
D. melanogaster
Annotation Symbol
CG3234-RS
FlyBase ID
FBtr0333259
Feature type
Associated gene
Evidence Rank
Length (nt)
5214
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 32 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCATTCAGCATTGTGCGTTCCAAATATAAAACAAAAATAATTTCATCAGTGTATATAACAGCACTGAAACTATAACACGA
        TCTATTCTGCAAAGAAACCCAAAAAGTGCTCAGAAAAGCTCAATTGCTTAGAAACATAAACAATCAGCTTTAATTGTTGA
        TTGCAATTCGGCTAAAACTAAAACAGTAAAATTGTCTGCGATAGAAAAAATTTAAATAATTGTTACAGATACCGCGCAAA
        TGGCTAAGAAGTACCTCAATGTTCGCAGTCGACAATGAGCAGAGTTAGGCAGCTCCACAATCACATCTGGAATAATCAGA
        ACTTTGATAAAGTGAAATCGGTTATGGACTGGTTACTAGCAACTCCGCAGTTGTACAGCGCGTTCTCCTCCTTGGGTTGC
        TTGGAGGGCGATACCTATGTGGTCAACCCGAATGCATTGGCCATTCTGGAGGAGATCAACTACAAGCTCACCTATGAGGA
        CCAAACACTGCGCACCTTTCGACGGGCCATTGGATTTGGCCAGAATGTGAGGTCAGACCTGATACCGCTGCTGGAGAATG
        CCAAGGATGATGCGGTCCTGGAGTCGGTCATCCGGATACTCGTCAATCTGACGGTGCCGGTGGAGTGCCTCTTCTCCGTG
        GACGTGATGTACCGCACGGATGTGGGTCGCCACACCATCTTCGAGCTGAACAAGCTGCTGTACACCAGCAAGGAAGCATT
        TACCGAGGCCAGGAGCACCAAGAGCGTGGTGGAGTACATGAAACACATACTGGAGTCGGACCCTAAGCTGTCGCCGCACA
        AATGCGATCAAATCAACAACTGTCTGCTGCTGCTGAGAAATATCCTGCACATTCCAGAGACGCATGCCCATTGCGTGATG
        CCCATGATGCAGTCGATGCCGCATGGCATCTCCATGCAGAACACGATCTTGTGGAATCTCTTCATCCAGAGCATCGACAA
        GTTACTCCTGTATCTGATGACCTGTCCGCAGAGAGCCTTCTGGGGAGTGACCATGGTGCAACTGATTGCTTTGATCTACA
        AGGATCAGCATGGCAGTGGCGATTCCAGCCCCATGCTGACCTCTGATCCTACCTCTGATTCCTCGGACAATGGCAGCAAT
        GGCCGTGGCATGGGCGGTGGCATGCGGGAAGGAACAGCGGCCACTTTGCAGGAGGTGAGCCGCAAGGGTCAGGAGTATCA
        GAACGCCATGGCCAGAGTGCCAGCGGATAAGCCCGATGGCTCCGAAGAGGCCAGCGATATGACGGGGAACGACAGCGAGC
        AGCCTGGATCGCCGGAGCAATCGCAGCCCGCCGGCGAGTCCATGGACGATGGAGATTACGAGGACCAGAGACACAGGCAA
        CTGAACGAGCATGGCGAGGAGGATGAAGATGAGGACGAAGTGGAGGAGGAAGAGTACCTACAATTGGGCCCAGCCTCGGA
        GCCCCTAAACTTAACACAACAACCAGCTGACAAGGTCAACAACACTACCAACCCAACGTCCAGTGCGCCACAAGGCTGCC
        TGGGCAATGAGCCATTCAAGCCACCACCTCCTCTGCCAGTCAGAGCCTCCACCTCGGCACACGCTCAAATGCAGAAGTTC
        AACGAATCGTCCTACGCGTCCCACGTATCTGCGGTCAAATTGGGCCAAAAGTCCCCACATGCCGGCCAGCTCCAGCTGAC
        CAAGGGCAAGTGTTGCCCACAGAAGCGGGAATGCCCCTCCTCGCAGTCGGAGCTATCGGATTGCGGTTATGGCACCCAGG
        TGGAAAATCAGGAATCCATTTCCACCTCCAGCAACGACGATGATGGGCCGCAGGGCAAGCCGCAGCACCAGAAGCCTCCG
        TGTAACACGAAGCCACGGAATAAACCACGGACGATTATGTCGCCAATGGACAAAAAGGAGCTTAGACGCAAAAAACTGGT
        CAAGCGCAGCAAAAGCAGCCTCATCAACATGAAGGGTCTGGTACAGCACACCCCCACCGATGATGACATCTCCAATCTGC
        TGAAGGAATTCACCGTGGATTTCCTCCTCAAGGGTTACAGCTATCTGGTGGAGGAACTGCACATGCAACTGCTTTCCAAT
        GCGAAGGTGCCCATTGACACATCGCACTTCTTCTGGCTGGTCACCTACTTCCTGAAGTTTGCCGCCCAACTGGAGCTGGA
        TATGGAGCACATCGACACTATTCTCACCTACGATGTTTTGAGCTACTTGACCTATGAGGGTGTGTCCCTATGTGAGCAAC
        TGGAACTGAATGCCCGACAGGAGGGCAGTGACCTGAAGCCCTATCTAAGGCGAATGCACTTGGTGGTGACGGCCATCCGG
        GAGTTCCTCCAGGCCATTGATACGTACAACAAAGTGACTCATCTGAACGAGGACGACAAAGCCCATTTGAGGCAGCTTCA
        GCTGCAGATTAGCGAAATGTCCGATCTGAGGTGCCTTTTTGTGCTTCTGCTGAGGCGTTTCAATCCCAGCATTCATTCCA
        AGCAGTATCTTCAGGATCTGGTGGTTACCAATCACATCCTCCTACTCATTCTGGACAGTTCGGCCAAACTTGGTGGATGT
        CAAACCATTCGCCTGTCGGAGCACATAACACAGTTTGCCACGCTGGAGGTGATGCACTACTATGGCATTCTGTTGGAGGA
        CTTCAACAACAACGGAGAGTTTGTCAATGACTGCATCTTCACCATGATGCATCACATCGGTGGCGATCTGGGCCAGATTG
        GGGTTCTATTTCAACCAATTATTTTGAAAACCTATTCAAGAATTTGGGAAGCGGACTATGAACTGTGCGATGACTGGTCT
        GATCTTATCGAGTATGTGATTCACAAGTTCATGAATACTCCTCCGAAGTCGCCACTCACCATTCCTACAACTTCCTTGAC
        GGAAATGACCAAGGAACACAACCAGGAGCATACCGTTTGCTCTTGGTCGCAGGAGGAAATGGACACACTTTATTGGTATT
        ATGTGCAGAGCAAGAAGAACAACGATATTGTGGGAAAGATAGTTAAGCTCTTCAGCAACAACGGCAACAAGCTGAAAACC
        AGGATTTCTATTATCCAACAACTTTTGCAACAAGACATTATCACCCTGTTGGAATACGATGACCTGATGAAGTTCGAGGA
        TGCGGAGTATCAGAGAACTTTGCTGACAACTCCCACTTCCGCAACAACAGAGTCTGGAATTGAGATTAAGGAGTGCGCCT
        ACGGCAAACCCTCAGATGATGTTCAGATCCTGCTGGACCTGATCATTAAGGAAAACAAGGCGCAGCATTTGTTATGGCTG
        CAAAGGATCCTCATTGAGTGCTGCTTCGTTAAACTGACCCTGCGGAGTGGTCTCAAGGTTCCGGAAGGCGATCACATCAT
        GGAGCCGGTGGCCTACCACTGCATCTGCAAGCAGAAGTCCATTCCGGTGGTGCAGTGGAACAACGAGCAATCCACTACGA
        TGCTGTACCAGCCTTTTGTTCTCCTGCTCCACAAGCTGGGCATTCAGCTGCCGGCGGACGCGGGCTCGATCTTCGCCAGA
        ATTCCGGACTACTGGACACCGGAGACAATGTACGGACTCGCCAAAAAGCTGGGACCGCTGGACAAACGTGAGTTAAAGTC
        AACCACAGAAAAAAACAACCCATTTGTCATTCCACAAAGGTGATGTATATACCGTTATCAACAATTTTTGCTCTCTCTCT
        GTGTGAAATTTTGATCATGGGAATCTCGCCCGAAACCGAATCCAAATCCGTGCTTCCATCCATTCCCATTCTCATTGTGT
        GTCCGTCGGTGTATCTCGATATGCTGTGTGCCTCTCTCCTTCTCCTCCTTCTGGGCTCTTATAGTCAACCTCAAGTTCGA
        CGCCAGTGAACTGGAGGATGCGACGGCGTCGAGTCCGTCGCGTTACCACCACACCGGACCCCGCAACTCGCTCAGCTCGG
        TAAGCAGCCTGGACGTGGATCTCGGCGATACCGAGGAGCTGGCCCTTATACCCGAGGTGGATGCGGCCGTGGAGAAGGCA
        CACGCCATGGCATCCACGCCATCGCCCAGCGAGATTTTCGCGGTTCCCAAGACGAAGCACTGCAACTCGATCATCAGATA
        CACACCAGATCCCACGCCTCCAGTGCCCAACTGGCTGCAGTTGGTCATGCGCAGCAAATGCAATCATCGCACAGGTCCGT
        CTGGTGATCCCAGCGATTGCATTGGCTCCTCGTCGACAACCGTGGACGATGAGGGATTTGGCAAGTCCATCAGTGCAGCC
        ACTTCGCAGGCGGCGAGCACCTCCATGAGCACGGTTAATCCCACAACCACTTTGAGCCTGAACATGCTAAACACCTTCAT
        GGGAAGCCACAACGAGAACAGCAGCAGTTCTGGTTGCGGGGGCACCGTCTCCTCCCTGTCCATGGTGGCTCTGATGAGCA
        CCGGCGCGGCAGGCGGAGGAGGTAACACCTCCGGGCTGGAAATGGATGTGGACGCCTCCATGAAGTCCTCGTTCGAGCGG
        CTGGAGGTAAACGGATCGCACTTCTCGCGGGCCAACAACTTGGACCAGGAGTACAGTGCCATGGTGGCATCTGTGTACGA
        AAAGGAGAAGGAATTAAACAGCGACAATGTCTCTTTGGCCTCGGACCTGACCAGAATGTATGTGAGCGATGAGGACGATC
        GACTTGAGCGAACCGAGATCCGGGTGCCCCACTATCACTGAGGATCCAATTCCAATCGATCCTAACCGATCCGATCCGAT
        ATCCGAGTTTTGAGTGAGGCCCACCCAGCTGGAAAGAATTGTACCTTAATCAATCAAATCAAGTAACGTTTAATATCACC
        CGGCACAAGGATTGTACATTTTATGACCTCTAAATGCAAAAGTATACCTGATTAATTAGCTACGCATAACGTAAATTACG
        CGGATAAACAAAAAAAGTCCAAGCAGAAAGTGAAGAAAAGTGCATTATTTGGTTAATGAATGTGAGGCTCTGCAGACTGT
        TTGCCTATGCTAGCCCACTAGATACTCTTAAGTTAACCTTAGTTTCCAATCGTATTCGGTATACCTACCTACCACATACA
        CACACATACATGTAAATGGGCAGTTCCTGGTTCAAATAGTGCAAATATACACACATAAATCTATTTACACGTTTAAGAAA
        GAAGAGCGACCGGTGTCCATCCACCAAAAACCATCTGTATGTATATCCTTAGTCATAAGTTATGCTTAGCAGTAATAAAG
        CTTTCCCTGTAGCC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0077567
        5073
        FBtr0333252
        5077
        FBtr0333253
        5641
        FBtr0333254
        3136
        FBtr0333255
        3525
        FBtr0333256
        5404
        FBtr0333258
        5020
        FBtr0445397
        5073
        FBtr0480508
        5931
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305457
        1099
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0077256
        1398
        FBpp0305450
        1397
        FBpp0305451
        1131
        FBpp0305452
        890
        FBpp0305453
        891
        FBpp0305454
        1398
        FBpp0305456
        1366
        FBpp0401565
        1421
        FBpp0428305
        1365
        Comments

        Based on cDNA(s) with retained intron; results in premature stop codon and shorter protein isoform (FBrf0084216); may or may not produce functional polypeptide.

        Transcript terminates at site supported by polyadenylated cDNA.

        Downstream translation start supported by FBrf0092669 and FBrf0101975, and by comparative analysis across Drosophila species.

        Corresponds to tim-M (FBrf0244295, FBrf0244296).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        tim-RS
        Secondary FlyBase IDs
          References (0)