Open Close
General Information
Symbol
Dmel\csw-RD
Species
D. melanogaster
Annotation Symbol
CG3954-RD
FlyBase ID
FBtr0333260
Feature type
Associated gene
Evidence Rank
Length (nt)
7119
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 58 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTCTTAAATCGACTGGCCACACCGCACAGCCCAGTAAAAAAATAGTTTTTTTTTTGTATCCAACCAACCAACTGTAAAAA
          TAAGTTTAAACAAAGCATCTACTCATAAGTTTCATTTTTTTCCGTTAAGTGTCAACATTATTTATTTTTTAAGTGTGCAT
          TCAATAAGAAAATGTCATCGCGAAGGTAAATCCAATAAGAAATACGACAATGTTCCGCACACACACGCACGCAGTCTCGC
          ACACACTCACACACACACACGGACACACACTCGCAATCACACACGCACGCACGCTCCGCTCCCAACTGGGCTATTTACAT
          ATGTATAAGTAGATACAAAAGCAAGGCAGAGCGAAAAAGAAACAGAAACAAAAAACAAAACTGCTGAGATAAAAAGTGCA
          CCAAAGTGTTGGTCGCGGGGGGGCGCCAGGGTGGATGCAGCGGATCCGTTGCCTCTGCACTGCTTCATCCTCAGCCTCAG
          CCTGTTGCCCACCGCGGAAGCAGTGCGGTAACCAGTGACAATTGACCGAAAACGATGCACACACCCCACTGTGCCCCACT
          GTTCGCCACTGTGCTCCACTGTGCGCCACTGCACCTGCCACTGATGACCACTTGGTATGCAGGGCAGGAGGCACCGGAGG
          CTGACCACAAACGACATTCGCACAATGGCCAGTGGCAGCTGACAACACCCATATGTTTGCCCACCGGATGGTTCCACCCA
          ACGATATCTGGCATCGAAGCTGAGAAACTGCTGCAGGAGCAGGGATTCGACGGCTCCTTCCTCGCCCGCCTCTCCTCCTC
          GAATCCGGGCGCCTTCACGCTCTCCGTGCGCCGCGGCAACGAGGTGACCCACATCAAAATCCAAAACAATGGCGACTTCT
          TTGATCTCTACGGTGGTGAAAAGTTCGCCACACTGCCGGAACTGGTACAATACTACATGGAGAATGGCGAGCTAAAGGAG
          AAGAACGGCCAGGCCATCGAACTCAAGCAGCCGCTGATCTGCGCCGAGCCCACCACGGAAAGATGGTTTCATGGCAATCT
          TTCCGGAAAGGAAGCGGAAAAATTGATCCTGGAGCGGGGCAAGAATGGTTCGTTTCTCGTCCGTGAATCTCAGAGCAAGC
          CTGGCGACTTCGTCCTTTCCGTGCGCACGGACGACAAAGTAACGCATGTCATGATTCGATGGCAGGACAAGAAGTACGAC
          GTCGGCGGCGGGGAATCCTTTGGCACCTTGTCGGAACTGATCGATCACTACAAGCGTAATCCCATGGTGGAGACGTGCGG
          AACCGTGGTGCATCTGCGACAGCCATTCAACGCCACACGAATCACGGCGGCCGGCATCAATGCCCGGGTGGAACAGCTGG
          TCAAGGGAGGTTTCTGGGAGGAATTCGAATCGCTGCAACAGGACAGTCGGGACACATTCTCGCGCAACGAGGGCTACAAA
          CAGGAGAACCGCCTCAAGAATCGCTACCGCAACATATTGCCATACGACCACACGCGCGTCAAGCTGCTGGACGTGGAGCA
          TAGCGTGGCCGGAGCCGAGTACATCAATGCCAACTACATACGGCTGCCCACCGACGGCGACCTGTACAACATGAGCAGCT
          CGTCGGAGAGCCTGAACAGCTCGGTGCCCTCGTGCCCCGCCTGCACGGCTGCCCAGACACAGCGGAACTGCTCCAACTGC
          CAGCTGCAAAACAAGACGTGCGTGCAGTGCGCCGTGAAGAGCGCCATTCTGCCGTATAGCAACTGTGCCACCTGCAGCCG
          CAAGTCAGACTCCCTGAGCAAGCACAAGCGGAGCGAATCCTCGGCCTCTTCATCGCCCTCCTCCGGCTCTGGGTCCGGAC
          CAGGATCGTCGGGCACCAGCGGAGTGAGCAGCGTCAATGGACCCGGCACACCCACCAATCTCACGAGCGGCACAGCCGGA
          TGTCTGGTCGGCCTGCTGAAGAGACACTCGAACGACTCGTCCGGAGCTGTTTCTATATCGATGGCCGAACGGGAACGCGA
          GAGGGAGCGCGAGATGTTTAAGACCTACATCGCCACCCAGGGCTGTCTGCTCACCCAGCAAGTGAACACGGTGACGGACT
          TCTGGAACATGGTCTGGCAGGAGAACACGCGGGTGATCGTCATGACCACCAAGGAGTACGAGCGCGGCAAAGAAAAGTGC
          GCCCGCTACTGGCCGGACGAGGGTAGATCGGAGCAGTTCGGCCACGCGCGGATACAGTGCGTCTCGGAGAACTCGACCAG
          TGACTATACGCTGCGCGAGTTCCTCGTCTCGTGGCGGGATCAGCCGGCGCGCCGGATCTTTCACTACCATTTCCAGGTGT
          GGCCGGATCACGGAGTGCCCGCCGATCCGGGCTGTGTGCTCAACTTCCTGCAAGATGTCAACACGCGTCAGAGTCACCTG
          GCTCAAGCGGGCGAGAAGCCGGGTCCGATCTGCGTGCACTGCTCTGCGGGCATCGGTCGCACTGGCACCTTTATTGTGAT
          CGATATGATTCTCGATCAGATTGTGCGCAATGGATTGGATACTGAAATCGACATCCAGCGCACCATTCAGATGGTCCGAT
          CGCAGCGTTCCGGTCTTGTGCAAACCGAGGCGCAATACAAGTTCGTCTACTATGCGGTGCAGCACTATATACAGACCCTG
          ATCGCCCGGAAACGAGCTGAGGAGCAGAGCCTGCAGGTTGGCCGCGAGTACACCAATATAAAGTACACGGGCGAAATTGG
          AAACGATTCACAAAGATCTCCATTACCACCAGCAATTTCTAGCATAAGTTTAGTTCCGAGTAAGACGCCACTGACGCCGA
          CATCGGCGGATTTGGGCACTGGGATGGGCCTAAGCATGGGCGTGGGCATGGGCGTCGGCAACAAGCACGCATCGAAGCAG
          CAGCCGCCGTTGCCGGTGGTCAACTGCAACAATAATAACAACGGCATTGGCAATAGCGGCTGCAGCAACGGCGGCGGGAG
          CAGCACCACCAGCAGCAGCAACGGCAGCAGCAACGGTAACATCAACGCCCTACTGGGCGGCATCGGCTTGGGGCTGGGCG
          GCAATATGCGCAAGTCGAACTTTTACAGCGACTCGCTGAAGCAGCAACAGCAGCGCGAGGAGCAGGCTCCGGCGGGAGCA
          GCAAAATTCAAAAACATTCCCAAAGACATGATCGGCTTGCGACCGCCAAGCCATGCGCCTGCGTTGCCGCCGCCACCGAC
          ACCGCCGCGCAAAACATGACAAATGAATTTCTAAGTCGCGACGCCCCCTTGACACGCCCCCTTGACACGCCCCCCTGACA
          CCCACCTCCCTCCACACGCACACAGACCACATATGGTTTTCATTTTAAATGTCACCCAGCCGCCGCCCCAAACCCAAAAC
          CCAATCCCTCGACTATGTTTTACTGTTGTACCACGTTCTACGTTTTTTTTTTTTTTTTATAATTGTAATCTATATACTTT
          TTTGTAATTGTGTGTAATGTAATGTTTAGTTTTATGTTATTGTCTCGCTTTATGTTGTAAGTGTTCCCTGCACACGAAAA
          GCAGTAACCCCACCACCACCCCAAAACCCAAAACCCAGCATATTTATGTAGTAGTATTGTAAGAATCCCCGAACCGGTAG
          TTGAGGATACAATCTGGGCGGAACTGCAGCAGATCCGCCAAAAAACAAAAACACATTTTTAAGCAGAATCGCAGCAACAA
          AATATAACACCCGTTCCCTGTTCCAAACCGCTTGAATTTGGTGGAATCGGCCTTGATAGTATTTCACTTTCTTGAAAATA
          TTCGCTTTAGATAAGAAAATTGACTTGTGACAAATATTTACATGTATTGCGCTGGTTACAAACCACAAAAGTTGCTTAAC
          TTTAAATTTTACGAATCGACATTTATGATATTTCGCATGCTTGAAAATAGTTGTAGTTTCCTATTTGGGAATCATTGAAA
          AATCCATTTATAAAGCGAAATCCAGTTCTGGCACGTTCAATTTGAATCGGTTAATTTCTAATCTAGTTGGCGAAAAAGTG
          AAGAAAAGTGAAGTCCACCTCCTCCAAATTCAACTTGAAACGGAAACGGGTTACCGGTTGGAGTGCAAATAAAGTTTTTA
          GTGTAGTAAGTGTTGACAAAATCGATAGAGAAGAAATTAGAGGAGTAACTGAGGCAGTAAGCACGTAACGATAATGATAC
          AAAAAGCGTTGATTGTGATTCGAGTGACAGCGAGAACAGAAACTGAAACAGTAACAGTAACAGTAACAGATGAGAACAGA
          TGCGAATGGGATCAGTACAGAACAGAACAGAACAGCGGAGACGCCAACCGAACAGAACAGAAATGAACAGAAGAGAAGAG
          AACAGATTAGAGGTAAAAGAAAAAGCTAAGAAGCGCTTAAGCGTGTCGTCCCTAGAATAAGAAAACTAATATTACAGCTC
          CACAGATCCAGATTCAGATCCAGATCTATATCTCTAGCAGCCAATTTCTGATTTCCCCTTCCCTCTTAGTTTTCCCATTA
          ATTTAGTGATTGTGTGTATATTTTTAATTGTATATTGAAGATTATTTATAGCGATTGTCCATTGTGTTACATTTCAAATG
          TTCGAAAGAATTGTATTTAGAAAGTTTGTACTTTAGAAATTATGCATTAATTGTGTGTCTGTGTCTCTCTACCCAGTCTC
          CCTATCTCTGTCTCTCTCTCTCTCTCTCCCTCACTGTCTATGCACGAGTGTTTTCTTAACTAAGTTTATTATTTCAACGC
          TGAAGCGTAATCAAACTATATATGCAATATTTAAGCACAGTACCTTGGGCGCTGCAAAGAAATTAAAAAATTTTAAAATA
          AAAACAAACTGCTAAATCATAAATACAAAATATATACAGGAAGGAATAATAGCAGCGAAATGTAAATCAATTAGATTATT
          GTGCAAATTTGAGTAATATATTTAAAACATACCCTTATTTTATCTTATTTAACTTTATGCTTTTGTAAGTGCTTTAAATT
          GTTATTCATCTTGATCTTGCAAAAAAATGAAAAAACCACAAAACTGAAAAACGAATACAAAACTAAAAAACAACACAAAT
          TATATTTGTATTTATACAGAAAAATAAAACATTTTATATGCGATACACGATAGCACATTATTTTTTATTTTCCCTGCATG
          TTTGTTGAACGCTTTTCCCTTTTTGGTTCTCAACTTCAGTTATGTTACCACACATCACCAACGAACTGAAAGAAACCCGA
          ACACTTTGGAACATAGCCTTATATAAAACGCCTCGACGACCAAGACGGAAAGTTGAATCACACCACGGAGAAGAGGGAGA
          CATCTCCCCTCTCCCAGTTAGAACAATAAGTAATCATGTGTTCACCCCCACCACCCACACGAATCTAAACTGACCCCTGA
          CCTTCCACCAAAGACACTAGAATAATATTATTCTAATGTCTTTGCTTCCACCCACCATCTGAGCACTAGCGGGTGATCCC
          GATCGGACGACAAACGTGTGTGTAAGTGCGTGATCTAGTACTTTATATAGTTAGCCTATAATACGATTATTCAAACGGAA
          TATGTCGAAGCCTGGCTTCGACTGGGCGGCGACCTAGTGGCCCCCAAAAAACGAAGGTGAATCCGAATATGAATCCCACT
          GGGGATACGATATGTTTTGATCTTGGAGCGCGGGGCGAACAAAGTCGCGCGCTTCTTGTGTTGAATTTTTATAGCATATA
          GAAAGAGGTGGATATCGGATATGGATATTGAAGAACGCAGTCCAATGGAGCAGCCGGCGGAGGGAGAGATGAATGCCAAA
          GCACAAAAGCCAACAGCAACAAAACACCAATAGGCCTCATCGCAGTCATTTGACCACAAATCTGACAAACAACGATGTTA
          TAATCAATAAGAGCGAACCAAAATCAAAATAACGACGTGAATATTGAGGGAGGGATCGATGGAGACCCAAACACCAAAAC
          AAAAAAAAAAAAAAACAAAAAAAACAAGAGCAAGGAAACGCTTTAAACTTAAATAATTCTAAAATTGTATCTAGGCAATA
          TCGAAATGTAAACCACACACCAACTATCCATAGTAGACAAACAAACAAACACCAAGAAAAAATTGCTTGAGTGACTTACT
          TTAGATAACGATATTCTCGGGTAGGACCTCGAAACCCCAGCAACCTCGGACCTCAACCGATTTCCTCGTGCCCTCGACCC
          GAATCCAACCCAACGTCCCCTCCTCCAGTACGTCTATAAGCTAACCACGCGATCCAACCTCAACCCGTGTTCATAATCCG
          ATGAGAAGTTGTGCGATTTTTAGTGAAACCTCGGTGCGGTTTCGATGTTGCAAGAATTAAAACCAAATAGAGACGACGTT
          TTCTTTGTTCAAATGTTGCCAATTTGCAAAATACAAGTGTTAAACTACCATATAGTATATGGAGTATGAATAATATATAT
          TTAGATGCGAAATACAGCTCAGTACTCAGCTCAGAAGCATTTTCATTGAGCCCAAAACGAGACGGCGAGGCAAACGTTTA
          TGTATCGGTATACAAGAAGCAGCTGAGAGGTAGTTCTCCTGCCATATAAAATATTAATCGACCCAAAAACATTAGAAATC
          CGTGTAGAATACTGCGATTTGATTGAAACTATAGATAACAATCGAGAACAAAATGGTAAACGAGCCCACGACGAAACGCG
          ATTGACGCAATAAACAAAGTTTTCGTAGCTCTAGATCGTAAGATAAACAAATTAATGAAACGCAACAAAACGATCGCGAA
          ATCGAGACAAAAGGCAACACCAAATAAATTGTAAACAAAACCAAAGTCGTTGTAATGTTGAAGCAAATCTATATGTAAAT
          CAATCTGCAAGCGCTAACTAAACGTAACAAACATAAAAATTAAACACAGCCACAAAATATTATTATGAAATTAAATTGAA
          ACCTTAAGATGCATAGCTGTTCGAAACATTATACCGATAACAATATTGAAGATATATTCTACATTTTTATGTGTCTGCAT
          ATTTGAAAGAAAAATATATATAATTGAATAAACCATATTTCAAATAACCTTTCGGAAAATTACCATGTGTTTTTAGAATG
          AGTGACTACTACCCACATATTTGTTTCAATATCCACATATTTGGCAAGAAGGTACGAAATGAACAATTCCAATAAAACT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0070378
          4560
          FBtr0070379
          7664
          FBtr0070380
          4106
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0305458
          894
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0070362
          841
          FBpp0070363
          945
          FBpp0070364
          682
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          csw-RD
          Secondary FlyBase IDs
            References (0)