Open Close
General Information
Symbol
Dmel\CG6163-RB
Species
D. melanogaster
Annotation Symbol
CG6163-RB
FlyBase ID
FBtr0333387
Feature type
Associated gene
Evidence Rank
Length (nt)
1607
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      AATTGATGTCAAAGGACGCAGTTGTGCTCCGCCGGCGCAGTTTCACATCGCCTTTGGAATCATTGCCGCGGTACGGTATC
      ATTCAGTGCCAGTGTGACCAGTTTCGCTGTGGCCATGCCCAAGGAGGATCCGTTCGTAAATCGAGCCCAGCTCTTGAAGG
      CGATCAAGAAATATCCGGAGATCTGGGACTCCAACAACAAGCTGCACATGTGCCGCAGCGTCACATCGCCCATGTGGACA
      GAGATCGCCGAGCAGTTCGGCGGTCATGTGCCGACAGTTAAGCTGCAATCGATCTGGAGCCAGATGAAGTACCACTATCA
      CAACTTGGTCCACCGCCAGATCCTCCACAAGGATCGATTCAACACCAAGTGGGAGCACTTCGAGCCCATGTCCTTCATGT
      ATAACATTACGGTGGCAAAGATCGTAGGCGCTCAGTCGAGCGGCGGCAGTGGCGGAGGCACCTCCTCCGATGCCCCATCC
      ACAGCCACTGAAGCAGCAACTGTGGGGGAGGAACCTGCTGCCCCAGTGGCGCCTCCGCCATTACCCACCGCCACCCATGG
      TCGCGGACGACCCAGTGGTAGCTTCAGCTGGCTGCAGACCGCAACCACACCCACCGCCCCTCAACTGCCGCATCTAATCA
      CTCAGCCGCCCCATAGTCAAGGTCATGGCATGACATATACCGCTTTCACGGGGCTGGTACCTCCACCGGCCACTGTGGCC
      TCAGAGACGGTGGCCACGCCGCCGCGAAAGTTGGGCCGCCCCAGTTCGTTGCACAATAGCATGCGCGGACGTATCATCGA
      TGCCATCAAGACGCGTCCATCGTTGTGGGCTGGGCGCCAGCGGAGTGAGAAAGGACAGGGTCAGAGTAGAACCTCAGCGG
      TTTGGAAGGAAGCGGCCATGGAGATGGGTCTGACACCGACTCTTATGCAAACGCGCTGGTCAATCATCAAGCAGCGCTAC
      GTAGACGAACTGCAGAAGGAGCGCCACGCCCAATACTCCCACCAATCCTTCCGCTCCACGTGGGAACACTTCGATCGAAT
      GTCCTTCATGCGGGAAATTCTGCTAAAGAAGGTCGATGAGAGGGAGCAGACACGCGAACAGATCCAGGAGATCGTTAGCG
      AGCAGCAGCACCACCAGCAGACGCAGCACCATCCGTCACAGCACTTGCACCACTACCGTCCACCACAGCCGCCAGCAGGA
      TTGGTGGAGCACGCCCAGGACATGCCAATCGGATTGGTGCAGCACCACCATCAGGAGGGACACCATCCGACTTTGGCCAT
      GCACCATCCGCAGCACTCGCAGCCCATTCGCCGTCGGGTCAAGCACGAGTCCGATCTCGAGTGGGATCCCTTTGAGATGA
      TTCTCCATGTCCATGGTGCCGGAGAGCCAGCTGCCAATTGAAGACTGAGCAAATAGGGGCAGTTAAGCCCTAGACACACC
      TGAGAAAAAGCCTGCACCACTTTGTTTTTTTTTTGGGCACTAATTAATATTAACTTACTAGATCAAATACTTCAATATAA
      TTGAACAAAATTAACAAGATTTCACTTGTTTTTTTTTCTTGATTTGATATAGGTTTCTTCTCAGGTGCAATTTGAAGACC
      CTAAAAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0076181
      2020
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0305579
      428
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0075911
      428
      Comments
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG6163-RB
      Secondary FlyBase IDs
        References (0)