Open Close
General Information
Symbol
Dmel\CapaR-RC
Species
D. melanogaster
Annotation Symbol
CG14575-RC
FlyBase ID
FBtr0333458
Feature type
Associated gene
Evidence Rank
Length (nt)
1827
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CAGTAATCTGTGGCCATCTAAAAGATACAGTGGCTGTATTATACGATAGCGCATCGCAGATTTTTCGCTATCCATAAAAA
          TTCAAACGCCAATTGTCGTGTGCCATGTGCTATTCTAAGTTCCGTGGCGGCCGTTAAAAATTTTACACGAAATAAACAAA
          AACATTCAGCTCTGGGCTAAAATGAATTCATCGACCGATCCGACATTTTCCGAGTTAAACGCAAGTTTCACAAATACCCC
          AGATACCCTATTCGCCACTAGTGTTAGTTCGGATCCATCCCATGGATTTGGAGAGGAGGACTATGCCTGCGGCACCTTTA
          ACTGCTCTCCAAAAGAGTTTGTGGCCTTTGTGCTTGGACCACAGACCTTACCACTTTACAAGGCAGTTTTGATAACAATT
          ATTTTTGGTGGCATATTTATAACCGGGGTCGTTGGTAATCTCTTAGTGTGCATTGTGATTATTCGCCACTCGGCAATGCA
          CACGGCGACCAATTACTATCTGTTCAGCCTAGCTGTTTCAGATCTGCTGTACCTACTATTTGGATTACCAACGGAAGTGT
          TTCTGTACTGGCATCAGTATCCGGATCTCTTCGGCATGCCATTCTGCAAAATACGCGCATTTATTTCAGAGGCATGCACC
          TATGTCTCCGTCTTTACCATCGTCGCATTTTCCATGGAGAGATTCCTGGCCATTTGCCATCCATTGCACCTGTATGCTAT
          GGTTGGCTTCAAGCGCGCGATTCGGATAATAACAGCTCTTTGGATTGTTAGTTTTATAAGCGCCATTCCATTTGGACTGC
          TCTCGGATATTCAATACCTCAACTACCCATTAGATCATTCCCGCATTGAGGAGTCGGCATTCTGTTCCATGTCGCCCAAG
          ATTGTTAACGAAATTCCCGTGTTCGAAGTATCCTTTTGCATTTTCTTTGTCATTCCGATGATACTCATCATTTTGCTCTA
          CGGACGAATGGGAGCCAAGATTCGATCTCGAACGAACCAAAAATTGGGTGTTCAACAAGGCACCAACAACAGGGAAACGA
          GAAACTCCCAAATGAGAAAGAAGACGGTTATTCGCATGTTGGTATAGCTGCTGTGGTGATTACGTTTTTCGTGTGCTGGT
          TCCCGTTCCACCTGCAAAGACTCATATTCCTGTATGCCAAGAACATGGATAACTATTTGGACATAAACGAGGCACTCTTC
          TCGATTGCGGGATTTGCGTACTACGTTTCATGCACCGTAAATCCAATAGTGTACAGTGTGATGTCACGTCGCTACAGGGT
          TGCGTTCAGGGAACTCCTCTGCGGAAAAGCCGTGGGCGCCTATTACAACAGCGGATTTGCGAGGGATCACTCCAGTTTCC
          GGGAAAGCTCCGCCTACGACCGCGTTCATTCTGTTCACGTCAGAGCCAGCCAGCATCCAAATAAGTTCGAAACGGACTCC
          TCATCTGCAAATAGGGTGCTGATAAAGAAAACCTACAGCCTCCCGCTACCAAAAAATGCGGACTCCACGGTCCTGAGCAC
          CACGGACATTGTCATCGTGCTGGAAAACAGCCACACAGTTTGCGAGGAGCCCAAAGTTGAGAACGATATTTGGATCGAGA
          ACGAGGAGACTTGTATTTAAGCACGAGGCCATTTCAACATTTGTAGTTTAAGCCAAGGACGTCGAGAACAACCTTTTGTA
          GAACTAATTTAAGAGCTAAGAATTGCGTATTGGGAATTTAGTGATATGACTGGGAGTCTGTCTAAATTCAAATGTGCCCC
          CGCACAAAGGAGATTTATTTATTTCTACAACATCTCATAATATTACTAAATAAACCAACTGAGTTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0078379
          1822
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0305648
          301
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078034
          477
          Comments

          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CapaR-RC
          capaR-RC
          Secondary FlyBase IDs
            References (0)