Open Close
General Information
Symbol
Dmel\SP555-RC
Species
D. melanogaster
Annotation Symbol
CG14041-RC
FlyBase ID
FBtr0333534
Feature type
Associated gene
Evidence Rank
Length (nt)
1396
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTGATACAAATTGAGAAGCGAAAAAATTTCTAGTCGCAACACAATGTCTGATGTTGAAGTGGATCCACAGCAGGCTCAC
        CCCCATCCCATAGCGGCAATTGCCCCGAGGAGACGTCGTCCAACCGGTCGACGAGGAGGAGTAACAGGAGGGTTGTCGTC
        CGGTTCACTGGATGCATCATCTTCCACATCGCCGCCACCCCGTTTCTGTCCGCTGCCCAATGGCGTTGAGGATAACTGGA
        CGTGGAGCAAGCGGCACCGCTCCAAGGAAGTGGTGCTCAGAGGACCCAACTCGCGGACCGTGCACTTCCATCCCAACTGG
        AGCAAGGGCACTGCCGGTGTCCAGGGCAAAAGATCCCTGAATAACGGACGGCATTACTGGGAGCTTCATGTCTCGCAGCG
        CGTCTTTGGCACCTCGATAATGTTCGGTATCGGTACCAAGTCGGCACGGCTACATGCCAACGCCTTCCGGAACATGCTGG
        GCGAGAACGAACACGGCTGGGGACTGTCCCACAAGGGCGTGCTCTGGCACGAGGGCGTGGCCCTGCTGTACACGAAGCGG
        TTCCGCGAGAATCAACCCACCCAAATTGGCGTTCTCTTCGATGGCATTGAGGGCACACTCACCTTCTACAAGGATGGCAA
        GTGCCTGGGCGTTGCTTTCCGCGGATTGGATCAGATTGATGAGCCCCTGTACCCCATCGTATGCTCTACTGCCGCCAAAA
        CGGAGATGACCCTAAAGTGCACCAGGAGGGAGTTCGTCAACCTACAGGATCGCTGTCGGGCGGTGATCATGCGCCGCGTA
        CGAAGCGCTGCGCAGCTGGAGAAGCTGAAGCTGCCGCTGCCCATCGCCGACTATCTGAGCGAGGTGATCGACGAGAAGAA
        GCCACTGCGTCAGGTGAATCAGCTGGAGATGTGCATTATGAATTACGATTTGTATGAGGCCCGTGAATGATTTTAGTGCC
        ATCACATATTGGAGTGCCCAATGACTACCAGACGATGCAGTGGCTCCTCTGGGACGTGTGCATTTCTCGTAGTAGCTTTA
        GAGCGTGCTAAGTTTAAGCATTCGGAATTTGTGTGGATAATAGTCGTCCGACCTTTTGATTTGTCTTCATTTGTAGCGAA
        AATGTGGGAAAATAGGCCAATTTGGTGCAATATTTGTGATATAAGAAATGAGAAAAACGTTTTTCGGGGCTTCAAGTGCT
        TGCTAGAAAATCGCAAAATAATCTAGAGCTAAGCATATTTTTCGGTACAGACGAGTGTGAAATCTAGTCAAAAAGAACAC
        GCTGCTAAACTAATTTTGTAAATTCGCAGACAGCAATTAAGGCCTAAGTACTGTAATGTAACAAAATGAAAATGTGTCTA
        GTCATAAATTGCATATAAAGCAAAGTGTAATTTAGT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0079004
        2665
        FBtr0079005
        3042
        FBtr0333535
        1488
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305714
        301
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0078643
        301
        FBpp0078644
        293
        FBpp0305715
        293
        Comments

        Monocistronic transcript; alternative dicistronic transcript(s) exist.

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        SP555-RC
        Secondary FlyBase IDs
          References (0)