Open Close
General Information
Symbol
Dmel\CG31650-RG
Species
D. melanogaster
Annotation Symbol
CG31650-RG
FlyBase ID
FBtr0333539
Feature type
Associated gene
Evidence Rank
Length (nt)
1509
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CACATTGTCTGCATTTTCGTTTCTTTGGTGTACGCAAATAAATAAACGAATTTTTATGTGAACATGTATTAATATGTATA
          GCAGGCGAAAGGTGAACTGAGTTCATTGTGCTGTTGGGCATTACGTGTGCGTCCATCCGGTCTCCCTCCTCCGCCGGAAC
          ATCATCCCCCCCATCCACTCGAGAACTCGGGAAGCTGCCAAAAAAAAAGAGAAAACAAAGACCAAAGAACACGCCGCTTG
          GCATAATCAATTAAAATGCCTAGGAATCTGCCGCTCCTCCCGCTGACCCTCTGTGCCGTCGCCTTGCTGGCCGCCGTGGG
          TCCCATGCCCGCCCATGGGGCGGTGGCCAACAGTCACAAGCACGAGAAGCACCTTAGCAAGGAGCGGGTCAAGGACGGCA
          TCTACGCTCCCCGGGATGCCCACCACCACGGCGAGGATGGGGAGCACAACGTGGAGTTCGATCACGAGGCCATCATCGGC
          AACACGAAAGAGGCTCAGGAATTCGACTCACTTTCGCCAGACGAATCGAAGCGACGACTGTTGATATTGATCAAAATGAT
          GGATCTGAATAAGGACGAATTTATTGACCGGCATGAGTTGAAAGCCTGGATATTAAGAAAACTGTCGGAGGAAGAAGCCG
          CTGATCGATTTGAAGAAATAGACCAGGATGCGGACGAGAGAATTACGTGGAAGGAGTATCTCCAGGACACATACGCCATG
          GAGGATGAGGACTTCAAGAAGGAGACCATCGACTACGACAGCTACGAGGATGAGCAGAAGATGATCAAGCAGGACAAGGA
          GATGTTCAATGCGGCCGACACGAACAAGGATGGTGTGCTGACGCTGGAGGAATTCGTTTTATTCCAAAATCCCGAGGAGC
          ATCCACAAATGTTGCCAATACTGCTGGAGCACACGATGCAGGACAAAGATGCGGATCACGATGGCAAGATCAACTTCCAG
          GAGTTTGTCGGCGACGCAGCCTCGCACCACGACAAGGAGTGGCTGATCACGGAGAAGGAGCGCTTCGACAAGGATCACGA
          CTCCAATGGCGATGGCGTGCTGACGGGCGATGAGGTCTTATCCTGGATTGTGCCAAGCAATACGGCAATTGCCAACGACG
          AGGTGGACCATCTCTTTGTCTCCACCGATGAGGATCACGACGATCGCCTGTCCTACCTGGAAATACTCAACAACTACGAT
          ACCTTTGTGGGCAGTGAGGCCACCGACTACGGCGACCATTTACAAAACATTAACCATCTCTCCGACGAGCTCTAGATGCC
          ATTCAAAGCCCCATCGTGCTATAGTGAACCTGTGCTTAGTATTGTATTTCGTTTAAATAGTTAGTAAATTTATGTTTATT
          TATGTAAATTCAAGTGACAATTGCAAATCAATATCGCCAAATTCTTTTGAGCACTTCTTACGAATTTAATTTTCAATACT
          ATTTCGTTTGTTTCGTCATGTATCAATTACATTATGTGTAGTAATTTATATAAACAGAAACAAAAATCT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079033
          1647
          FBtr0079034
          1638
          FBtr0079035
          1521
          FBtr0301905
          1615
          FBtr0301906
          1515
          FBtr0301907
          1614
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0305719
          339
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0078669
          342
          FBpp0078670
          342
          FBpp0078671
          342
          FBpp0291119
          342
          FBpp0291120
          342
          FBpp0291121
          342
          Comments
          Transcript terminates at site supported by polyadenylated cDNA.
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG31650-RG
          Secondary FlyBase IDs
            References (0)