Open Close
General Information
Symbol
Dmel\Diap1-RF
Species
D. melanogaster
Annotation Symbol
CG12284-RF
FlyBase ID
FBtr0333619
Feature type
Associated gene
Evidence Rank
Length (nt)
2233
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 36 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TAAAACTACGACTTCGTGTGCTGACAGTTGTTTGTTTTTGAAATTTTAATATATTCAGAAATATAAATAGCTTGCAAAAT
      AGTTATTAATTAAACTTAAAAAAGTTTTAAAAAAAACATTCCAGTTTAGAGACGCACAGCTGGAATAGCCAACGAAAGTG
      CGGACATCCCACCCCCAAAAATAATTGCGCATCGCTTGGGCGGCAAAAAACTATTTCGACCGTTCCGCCCCGCTAGTTCT
      CTCTCTTTCCCCCGCCAGCACCCTCTCGCTCACTAGAAAGCCAAGCAAAACAAAACAAAACGAGAACGCAGAACCGACAA
      AACAAATACCTATAGGAAAGTGAGCTATATAGGCACATAGCTTTGGCGTAGTCGTTGCACGGCATTCAAACCCACCAGTC
      GACGTGAGCACAGTTGTGTAAACATTTTATACAGCAAAACTTATTTTAAGTGATTTTATAATCTTATCGTGGTGCGATAA
      GAGGTGAACGAAAACAATTAACGATTTGGTGGCCGAAAAAAGGCATTAAAAAAACCAATGATAAACTGATACGTTATCAC
      TGTTTAAAATGTCTCTGTTTCGACTTCAGAGGAAAGGAGCCAGAGAAGAAATTAAGAGTCAGGCAAACAAAGGAGCTAAC
      AACCAGAACACAAAATGGCATCTGTTGTAGCTGATCTTCCGTCTTATGGACCTATCGCTTTTGATCAGGTGGATAACAAC
      ACGAACGCGACCCAGCTATTCAAAAATAATATAAACAAAACCAGAATGAACGATTTAAACCGCGAGGAGACGCGATTAAA
      GACCTTCACCGACTGGCCGCTGGACTGGCTGGATAAACGCCAATTGGCCCAAACCGGCATGTACTTCACACACGCCGGCG
      ACAAAGTTAAATGCTTTTTCTGCGGCGTGGAAATCGGTTGCTGGGAGCAGGAGGATCAGCCCGTGCCGGAACATCAGCGA
      TGGTCGCCCAACTGTCCACTGTTGCGCCGGCGCACTACCAACAATGTGCCGATCAATGCCGAAGCATTAGATCGCATCCT
      GCCGCCAATAAGCTACGATATCTGCGGCGCCAACGACTCGACGCTGGAGATGAGGGAGCATGCCTACGCAGAAGGCGTCA
      TACCCATGTCGCAGCTAATTCAGTCGATTGGCATGAATGCAGTAAATGCGGCAGGCAGTGTAACTGGAACCGCAGCCCCG
      CAGCCGAGGGTAACGGTCGCCACCCATGCGTCGACGGCGACACAGGCCACTGGCGATGTCCAGCCGGAGACGTGTCGTCC
      TTCAGCCGCCAGTGGCAATTATTTTCCCCAGTATCCCGAATACGCCATCGAGACGGCACGCCTGCGCACCTTCGAGGCTT
      GGCCGAGGAACCTGAAACAGAAGCCCCACCAGCTGGCCGAGGCGGGTTTCTTCTATACAGGCGTTGGGGATCGCGTCCGC
      TGCTTCAGTTGCGGCGGTGGTCTCATGGATTGGAACGACAACGACGAGCCCTGGGAACAGCACGCTCTCTGGCTAAGTCA
      GTGCCGATTCGTCAAGCTGATGAAGGGTCAGCTCTATATCGATACGGTGGCCGCCAAACCAGTGCTGGCCGAGGAGAAGG
      AGGAGAGCTCTTCGATTGGAGGGGTCGCGGTGGCCAGCACACAGGCTTCAGAGGAAGAGCAGCAGACATCACTCTCATCG
      GAGGAGGCCGTTTCGGGGGATGTGGCTCCGTCCGTAGCTCCCACGGCAGCCACACGCATCTTCAACAAGATCGTCGAGGC
      GACAGCGGTGGCTACTCCCTCGACAAACAGCAGCGGCTCCACCTCCATACCCGAGGAAAAGTTGTGCAAGATCTGCTACG
      GCGCCGAGTACAATACGGCATTCCTGCCATGCGGTCATGTGGTGGCCTGCGCCAAGTGCGCCTCCTCTGTGACAAAGTGT
      CCGCTGTGCCGGAAGCCCTTCACCGATGTGATGCGCGTATATTTTTCTTAATAACCCCAATGCGCACCCAAGTCCTCAAA
      TTCAAAATAAACATGTCTAAAAAGAAAATGTGGGCGGAATGTGTTAATTATAAGCGTAGAAAAAAATCGTGGTTCAACAG
      GCGATCGCAACGGCCAGCTGTGGGGATGCCCGGCAGCTGGCCGTTGGACTTTAGAAGATCACAAAGCCTGCCAGTTATCG
      TAAGCCTACATTGTAATATTAGTTTAGTACAGCACTTCTATGCGTTATTTATAATAAAACTAATATATTACCG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0075500
      2018
      FBtr0075499
      1870
      FBtr0075501
      1820
      FBtr0333617
      1754
      FBtr0333618
      2304
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0305795
      438
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0075255
      438
      FBpp0075254
      438
      FBpp0075256
      438
      FBpp0305793
      438
      FBpp0305794
      438
      Comments

      Extended 5' UTR based on RNA-Seq and/or EST data.

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      Diap1-RF
      th-RF
      Secondary FlyBase IDs
        References (0)