Open Close
General Information
Symbol
Dmel\Dab-RI
Species
D. melanogaster
Annotation Symbol
CG9695-RI
FlyBase ID
FBtr0333626
Feature type
Associated gene
Evidence Rank
Length (nt)
8076
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 17 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTTTTCCCAAAAAAGATCAACAATGGCCGAGAGAGCTGCTCGTTTTCTGTACTGTATTTTGCGCCACAAAAATCACTAA
          ATAATAGAGTGAAATCTATGTGTACACACGAGTGCCTCAAAGAGTGTGTGTGTGTGTTTTTGTTTATTATTTCAATTGAA
          CAAACTGCGACAATCCAGTCCAGTCGAAAAAGAGAGTCACCGTGAGAGCATTCGAATCGTTTCCACGCTCTCATTCGCTT
          TTATTCATTCCATGATCGCGCATCGTTCTCCGCTAGAATTTAATTAAATCTATAGCGTCGCGAAAAATCGTTGTGGAATT
          TATGTATTGTTTGTCCCCCATTGTGTGCCCCCTCCAGCACCAACACCCTCTCGTCATCGTCCGCGTCCCAATGGAAATGT
          CAACACACACACACACAACAGAGAGGCCCGGAATGCTACACTGATTCTGTTGACACTTCGGTGACCAGAGTTCCAGAATT
          CCAGAGTTTTTCCAGCCAGCGTTTTCCCAATGAGCAGGAGCAGTACCCACTGAGACTTCGGCCGGGCGAAACATGGTCAA
          GTCCCTGGTGGCCAAGTTGTCCACAGCCTCCTCCAATCTCTCGTTGGCCAGCACCTTTGGCGGCGGCAGCGGCGCGGCAG
          AGGAAACGAATTACGCAAAACATCGCAATGATCCGGGACGCTTTTTCGGCGATGGCGTTCAGTTCAAGGCAAAGCTCATC
          GGCATTCTGGAGGTGGGCGAGGCCCGAGGTGATCGGATGTGCCAGGAGGCGCTGCAAGATCTCAAAATGGCCATCCGGGC
          GGCTGGAGAGCACAAGCAGCGGATAACCATCCATGTGACCATCGATGGTCTGCGGCTGAGGGATGAGAAAACGGGTGACT
          CCCTGTACCATCATCCGGTGCATAAGATCTCCTTCATCGCGCAGGATATGACTGACTCGAGGGCCTTTGGCTATATCTTC
          GGATCGCCGGACAGTGGTCACCGGTTCTTCGGCATCAAGACGGACAAGGCGGCCAGCCAGGTGGTGCTGGCCATGCGCGA
          TCTCTTCCAGGTAGTTTTCGAGCTAAAGAAAAAGGAGATTGAGATGGCGCGCCAGCAGATCCAGGGTAAGTCCCTGCACG
          ACCATTCCAGCCAGCTGGCCTCCCTGTCGTCGCTGAAGTCCTCCGGCCTGGGTGGCATGGGTCTGGGCCACTCGGATTTG
          GCCAGCGGAGGAATCTCATCCGGCCATGCCCTCACCCTGCTGGGCAGTAGTCTTAGCACCACGAATGGAACGAGCAGGCT
          GGGCGTGAGTCTTGACGTGGCCAAGGCATCCGGATCGGCGGCCAAAGAGGTCTCTCCGGAATCCGTGGCCGATCTTGTGG
          ACTTGGAGCAGGAGCTTACCTCGCTTCAGCGGGGAATCAGTCAGATGGAACGGATAACGCCAAACGAGCCGACCACCAGT
          AGCACTGGTGGTGCTGGCCATCCATCTCTAGCGAAATCAGCCAGCGAGGACGATCCTTTCGGAGACTCGTTTATCTATGT
          GCCCTCGTATAGCATACTGCCACCGCCACCTGATTCCGGACGCAACAGGCACAAGCCGCCCAACAAAACACCTGATGCGG
          TGACCAGTTTGGATGCAATGCTTTCGCCACCTCCTGGTACAAGTAGCTCCCACGGCTCAGCCTCCGCTGGACTACAGGCT
          GCAGATAACGACGATGACAACTGGCTGCAGGAACTGGACCAACAAAATGATGTCTTCGACACGTCCAAAGTGGTGAGCAG
          CAGTGGATTGGGTTCGGTTTTGGCCATGGCTCCGCTGGCCTCCAGCGAATCCACGGCCACTCCCACCCAACAACTGACGG
          AGGTTGCTGCAGGATCTGGACCTCTGGCTGATCTGGATATTGGACTAAGTACGGCCTTGGGAAATGAGGAACAGACCTCC
          ACCATTTTGTCATTGGATGCGTTCACGGATTTGGATCCGCTAGGCACAGGACGCACCAGGCCGTATGTCGATAAGAAATA
          CTTCTTCCAAGAGCTGAAGAATCCGCCGAAGAAGCTGCTCAAGGAGCTCAGCTCCGGCAGCCAGGCGGGTCTCGGTCTGG
          GTCTCTCTCTGGGTCAGTTGGATGGCCTCTTTCCGGAGGATAGCACCACCATCTCCACAACCACCACCACAGCTACTAAC
          ATCACCGCAGAACCGCCAACGCTGAACTCGCTGGAGAATCCCCATCCGCCGGCGGATCCCGTACTTCTGCCCAGGGATAC
          GGATCCGTTCTCGCCCACTCGGAAAAAGAGCGATCCAGATCCCTTCCAGGAAAGCGATCTCTTTGCCAAACTGGATGCTT
          TCGAGTTCGAGGCTCCGCCGGCGGTTCCAGCTCCCTCGATTCCAAATTTGGCCACGGAGACAAAAGCGAATGTATTCAAT
          GGACCACTTCAGGTGCAATTGCCACCAGAGAAGGAGTTGCAGCTTCAGCAGCCTCCGAGTACGGTGAGGAACCGTCCCAC
          AGCATCTGTTTCCGCACTTCCAAGTGGCGGAGCCCTTGATGTGATCTCCAGTATAAGCAACAAGAAGATGCCGCACCTTT
          TTGGCCAGGCCAGATCATTTGGCAAATCTGGTTCGGATATTGGTTCAAGTGTTAACATGCGCCGCCTGCAGGAGAGCGAT
          TCGTTGAGTGAAACAGAGGCAGCTCCCGAGCCACCGCCGCGTCCAGACTCGACTCCGTACTCGGAACCTCCGCCCCTGCC
          ACCCAAGAAGCAGTTCAGCGATCTGGTCATCCGACCTTCACCTGCAAATACCACTCAACCGCCAACTAGCGGAAGGTATG
          AGTATTTGAACAGTAATGTCACGGCAAGAAGGACTGCCTCCTCCGTTGACGCACCACCCATTCCATTGCCATCGCGCCGT
          GTTGGTCGCTCTGATGGCTGCTTTCCGGGTCCGGGAAGGCCAAGAAAACCTGGACACACCGAGGATGATTATCTAGCTCC
          GTTGGGAGCTCCACCGCCATTGCTGCCGCCACCCAGCCAAGGATCCTCGGCTCGCGCGAGACCTCAACGGCAGGCTTCGC
          TAGGCAGGCCGCAGGATATCTACGAAAACAAGGCGGAGATTCTGCAGGCTCAAGCACAGGCGCAGGCCCAGGCCCCGGAA
          GTAGCGCCCTCTAGCAATACCTTGGCTCCCGATATCACCCTAACTCAATTGCTCACCCTGGGAATGGATGATTTGGCTAT
          CAAACTGAACGTTCCCGCCAGCAAACTGAGCACCATGACTCTGGTCCAGTTGACAGCCTATCTCTCCGAGTATTTGTCCA
          GTGAAAAAAGCCAAGTTCACAGTCAAGAGAGGAGATCTTCGCCAGCAAACACAGCTCCTGCACCAGCTTCCACGGCAGCT
          GTGTTTAAGGTTAATTTTGATCAGCAGACCTCCTTTGTGGCCAAGTTCGACGACACTTTTGGCGAAGACGAACCAGTGAT
          GCCTTCGGGTTCTTCGGACTCCACCTTTGTGGCTAACTTCGCCAACTTTAACGATGCACCAACTCCGGTGCCGACAGTAT
          CGCCAGTTGTTGCGACAGTGCCCTCAGCAGATCGGTATGCCGTATTTCGCGAGATCATCGATCAGGAGCTTCAGCAGCAA
          CAGCAGGAAACGGATCTTATGGGCGATTTGACACCACCGCCAGTGGATGAGACCCAGGCCAAGGAAATTTCAGAGGGCTT
          GGAGGTGAACAATGTGGGTGCGGAGCTACCAATTGATGCCTTAGATGTCAAACCTGCGCCGAAGATTGACACAAAAATCA
          CCGAAGTTGTCGCCCAGGCCAAAGATCGTTACGCAGCTCTGCGGGACATAATCCTAGTGGAGAATCTCTTTGATAAACCA
          GCAATAGCAACCGACACTCAGCCTGAGAAGGAAAAGGATCTGTTGCAAGACTTTCCTGAGTTCAGTGATGAGTTCAACGA
          GGATCATGACCTTCGCCAAATTATGGATCATCAGAATGTTCAGACTCATGCCCGCGATCGTCATGGCTTGGTCGACAGCA
          GGGGCTTTCCAACAGAGCCTTCGTCTTCCGCTCTGACCGTGGGCGATTATGATGAGGACGAGGATGCTGATGCGGGTGGT
          GAGAGCAGTCTAGATAGCAATGAAAAGGACGCAGAGCCTGTCAGCGGTCAGGATCAGTATGAAAAGCTATCCACGTCGAC
          GCAACAACTAGATGCAGCTGCTCCGGCTCTAGAGGATGTGCAGCAGCTGCAGCAGCAATCCCTGCCTCCAAAGCAGGATC
          AAAAATTCCTCTCCATCCTAACGGCTCCCGGTGGTGGAACGAAAGATGACATCGAGATCGACGAGCTCATGCATCGTGCA
          ATTTCGAATCTCTCCCTGGACTCAAGGGATCGAGTTTCGCCCGCCACCTCCTCGGCAGCTCCATCACGTGGGGCTCCCGG
          CTTGCACACGCCCTCGCAATTCAATGATGTCAGCACGTCGCCGATTCCCCTCCAGAAACCAGGCATGGGCCCATCGCCTG
          TGCCGTCGCAGCTTTCGGCCGTGTCCCAACTCATCGATACCGCAACCAAACAAATGATGGGCGACAAGGATCGGGAAAAG
          CAATCCTGGGCTACATTCGATTCCCCGAAGGCAAAAGGCAAGGCTAGGCTAACGCTTCCGCCGCCACCACCTCCTGCATC
          CAACACTTCGCAACCGGATACGGTAGAATCGCCTTGCAGTTCGGATCCCCGGGATGACGGCTGGTCAAAGCAACAGCGTC
          GTTGGGCGAAGAAGGAGCGCCAGCAGACATCCTCATCATCCCGAGACCTAAGTCCCTGGGACGATGAAACGCCGGAGTAT
          CTGAAGCGGCGACAGTTGGCCGCCGCTCAAATGGCTCATCCCCATCAGCCCCCTATGCAAGCTCCACCTCAGCATACGGA
          TCGGCATGGATACTACATGCGACACGCCAGGCGAATGAACTCTTGCGACGAGGACTACGACTACGATGGGGAATTCGTTG
          CACGCCGAGATCAGCCACAACATCAACAGCAGCAGCGAAAGTTCAAGCACGGACTTTCTCGCAGCAGGGATAACTTTGAA
          TTGGAATCCCCCAGCTGGTATCATCACCCGGCGCACCACACATGGTCGCCTCAGGAGATTGAGCAGGTGCGCGTACGATC
          TTTCGATCGTACTGCTTACGAGCGATCCAGCTATGGCCCACCGCCACCCATCTACGACAAACGTGGACAACTGAGAGGCA
          AATATCGCGGAGATCACAGGGATAGGGAACGAGAGCGTGATCGCGACCGAGAGTATCGGGATTATGCTCGTCCAAGCTAC
          GATTTCGACTACGAAAACGTCTACGAGGAGCGTGGAGGTCGTTCACCGTTGGCCTACAAGCCAGGAAGAGGTGGTGGTGA
          TTATCTGTATGACAGAGAAAGGGACAGGGATCGGGAGCGCGATCGAAAATCCTTCGATCGGGAAAGTCTCGAGTCCTATG
          AGAGCGCCACCCGTCGTCGTCGCAGTTTTGGTAGTGGAAACGATGTTTATGGCAGCCTAGATAGTCGCGATGATTACCGT
          GGCGATAGGGAAAGGGATCGTGAACGTGATCGCGAGCAGATGAAGACCCGTTCATTACGAAAGCCAACAACTACGTCTGG
          AAAGCTCCGGATAAGTGGCGACATTGATTACGAGCAGGACTCGGAGCAGGACTTCCAGCAGCGATCTGGAGTACGAAGCC
          TGCAGCGTCCCAATCAGCTAGGCGGTGATGTGGTGCTGCCCTCCAATGCGGTAGTGGGTCCACAGCGATTGCGCAAAAGC
          AGCGGCTCCAGTCCCTGGGACGGAGAGGAACCGGCCTTGCCTGGTCAGAAATCTTGGAAGCGTCCAGCCAGCGCTGCTGA
          AACCGAAAGGCGACTGGCTGAGAGTCGCAGAGCGGTAGCTTTGGGTCAAACTCCCTCCGATGGAGAAAAAGAACGAAGAT
          TCCGCAAGAAAACCCGAGCCCGCAGTGCCAAAGATTTAGCCACCGTCGGTGCTCCCAGCGCTAGTACTTCTGCCCCGTCC
          AGATCGAGCTATGGGCGTGGCATCAGGGATAACTATGACTATATATGTCCAGGCCAGCGTAACGATGACGACGACGATGA
          TGATGAGGACTACGTGGATGATGAACCGCCAACGGATGAGGATAAGTTCGAGAGGTTGAACCGCCGGCGACATGAGATGC
          ACCAGCGGATGCTGGAGTCCGAACGTCGGCAAATGGAACGCCATCAGCCGCCATCGCTGGCGAAGCTTCCGGGCCAGAAT
          CGTACACGAGGCGTCGTGGCTAACAGTGACTATGGTTTTGTGGACAGTTACGAGCAGACTCCAACTCCCACGCCACGTTC
          GAATGCCAGTAGCACTGGACCGGGTGGCCTGATGATGAGTGGCGGGGAGTCCTCCGCTGGAGTTACAAGTTCCAAGTTCA
          ATTTTGACGATGGATTTGAGTCAGATTTTAATCAGAGCTCTCCGCCGCCGGCGCCAGCAGGTACCGCCTCCAGTTGCAAT
          TCCACGCCGGCGGGTCCAGTTTCGGCAAATGCGAACAACGGCGGATCGAAGAGCCTGTTCCGCTTCTCCAATGATTTTTC
          GGATCGCGAGAAACGGGAGCAGTTTGAGATGGATACACCGCCAACCTCAACACCACCAATTACGCAAAAACTGCGATTTG
          ACGATAATGTTAAGGTCTCCCAATTCGATGATGCTGCCTTTGAGGATGACTTCGCCAAGGCATCATTCGATTTTGAAAAG
          GAACAAGCGGGTTCTGCCACAGCAGGTGCCGGAGGATCTGGTGCTATGAGCAGGAAGCAAAATATGCGAACCAGCAAGCT
          GCAGCAGCGCCAGGAGCTCATCAAGAAATCCGAGTCGGTAAACATATTTGCCAAAAAGCAGGAGGATCCCTTCGAGGATG
          ACGAGTTCTTTAAATCACCAGACCAGGAACAGGCCATGGATCAGCACAATGATGACACTGAGGGCGGCAAATTTCAGTGG
          AGCGAGGACGCGAACTTTGCAAAGTTCGATGAAAACATGTGATTTGACCAACTGTTTGCCAAGGCATCGGGGCAGCGACC
          GGATCCGGACATCGATAACCACAACTATGCGGAGATCGATGTGGTCAACGACACGGACTTTTCATTTCTGGCCAATCTCA
          ATCACTACTATCAGCAGCAGCGACTGCACAGCCTGCGACAGAGCTTGAATCGCCATGTTTACTGCAACTTGCCAGTCCAG
          CAGTTGCAGGAGCAAGTGAATCAGCCGATGAAGAAATCCATCGCCACATCTACAAGTCCCTGGCATGAGCCAAAGGTCAA
          GTCGAAGCCGCTGCAGCAGCTGCTGAGGAAGCCGAAAAAGTGGAAACTCAAGCGCACCCTAGATGACTTTCTAAAGTGTC
          TGATTATTGCGTCCTCGGAGCATGTGTACGATTATGATGTGCTGTGGTAGGATTGGCGGATTGGGAAGATGAGGAGCAGT
          CTTAGAGAAGAGAGAGAAATAAAGAAACCATACGATATTTAATTCGCCACATATATCTAGTCAACTCAATCGCCATTTAA
          ACTTGCAATATCGTAACACTCCAACGAGGACTGTAGAGTTCCCTCTTACTCCCAGTTCTGCCCAAGCCAAAACATCACAC
          AGCTCTGATCCTATTCCAAAGCCAGATTGTATATATAGATTTATCCAGCAGTCGATTCCAAGCAAGCCATAGAGAAAACT
          TAAACGAGAACAAGTGTTTGTTAAAGCTACTCCCCACTCGTCAAATAACGAAATACTCACGCCCCCGCCCCGAATCATCA
          ATCGATCCGCAAATCGAAAGCAACTAATTAATTGCCTATGCTAGATGTCGTCTATTCCATATATATCGAATTATCCAAAG
          TGCAACCATTGTGCTAGCATACAATACCACATATATTCCTAGGGTACGTTTATGTTTTTGCATACTACAAGCATAATTTG
          TATGATTGTTTGATTACATAGTTAACTAACGACTAATTAGTTTAATTCCACGGCAATGTGTTTTTATGATTTGACTATAT
          ATTATACATAACTATATATTTATACGTAACTGAACAAGCAACTGAAACTGAACGATCAAGTAACTCCCAAACAGCT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0075318
          8461
          FBtr0305084
          7990
          FBtr0305085
          8449
          FBtr0305086
          7842
          FBtr0330189
          8301
          FBtr0330190
          8449
          FBtr0333625
          8067
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0305801
          2149
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0075077
          2224
          FBpp0293621
          2047
          FBpp0293622
          2200
          FBpp0293623
          2071
          FBpp0303222
          2360
          FBpp0303223
          2336
          FBpp0305800
          2146
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Dab-RI
          Secondary FlyBase IDs
            References (0)