Open Close
General Information
Symbol
Dmel\PGRP-SB2-RB
Species
D. melanogaster
Annotation Symbol
CG9697-RB
FlyBase ID
FBtr0333627
Feature type
Associated gene
Evidence Rank
Length (nt)
668
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            AAACAACATGAAGCTACAGTTGGCTCTCGTTCTATGTGGATTGACTCTGGCCTTGGGCCAGATTGTTCCCCGCAGCTCCT
            GGTGTCCTGTGCCCATCTCGCCGCGAATGCCCAGGCTCATGGTACCGGTGCGACTGATTATCATCCATCATACAGTCACG
            GCCCCTTGCTTCAATCCGCATCAGTGCCAGTTGGTACTTAGGCAAATTCGAGCCGATCATATGCGCAGAAAGTTCAGGGA
            TATTGGCTATAATTTCCTGATCGGCGGGGATGGTCGAATCTACGAGGGCTTGGGTTTCGGCATCCGTGGCGAGCATGCTC
            CCCGCTATAACAGCCAGTCCATTGGCATTGCTTTCATTGGCAACTTCCAGAATGCTCCAGGCTGCCCGAACCCTCATCCA
            AATCGCTGTGCAGCGTCGCCAGGTTTCGCCCAACTATTCCGTGGTGGGTCATTGCCAAACGAAGGCCACTGCTTGTCCGG
            GAATACACCTTCTCAACGAGCTCAAAAAGTGGCCAAATTGGCGACCAAAGCCTTAGGTTTCCATATGAATCATTCGAGTG
            TTGATGAAAGATGGAGACCCTAACATAAATATATCTTGAAACCCATTCTCTGTAGCTAAATTGATGTAAATAATTGTACA
            TTTTACCAAATAAACACATTTTTTAGAC
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0075320
            688
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0305802
            191
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0075079
            182
            Comments

            Transcript terminates at site supported by polyadenylated cDNA.

            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (1)
            Reported As
            Symbol Synonym
            PGRP-SB2-RB
            Secondary FlyBase IDs
              References (0)