Open Close
General Information
Symbol
Dmel\RhoGAPp190-RF
Species
D. melanogaster
Annotation Symbol
CG32555-RF
FlyBase ID
FBtr0333661
Feature type
Associated gene
Evidence Rank
Length (nt)
7411
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 130 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CATTAGTTCCAGCTCTAGTTTTTGTTGTTGTTAAATTAAAGCTCGGATGTGAATTACAATAATTGAACGTCAAGATGCGT
      CAGTTTAACATCTCGGTCATTGGACTATCCGGGACCGAAAAGGACCGCGGGCAGGTGGGAGTGGGCAAGTCATGCCTGTG
      CAACAGATTCATGCGCCCGATGGCCGACGACTACTTCATCGATCACATATCAGTGCTTAGCCAAAGCGACTTTAGTGGCC
      GGATCGTGAACAACGACCACTTCCTTTACTGGGGCGATGTGCGCAAGACGACGGAGGAGGGCGTCGAGTACCAGTTTAAT
      ATCATCGAGCAGACGGAGTTCATGGACGACTCCACGTTCCAAGCCTTTAAGGTGGGAAAGATGGATCCATACTCAAAGCG
      GTGCACGGCCACCAAGGTCTTCTCCGCGGAGAAGCTAATGTACATATGCAAGAATCAGTTGGGCATCGAGAAGGAGTACG
      AACAGAAAGTCATGCCCGATGGCCGGCTCAGTATCGATGGCTTTGTTGTCGTCTTCGACGTTAGTCCAGTGCCCAATCGC
      AGTGTGGAGAAGCAGGTGGAGTTCGTGCAGAATGTCATCGCAACCATACTAAAGAACAAGAAGCCACTGGTGCTGGTGAC
      CACAAAGAACGACGACGCTTATGAGTTGTATGTTCGAGAGGCGGAGAAAATTAGCCAGCGAAAGGACTACAAGAGCACTG
      TGCAGCTAATCGAGACGTCGGCCCACGAGAGCATCAACATCGATTTGGCATTCCTCCTGCTCGCCCAGATGATCGACAAG
      GTTAAGAACCGTGTCAAGATCATCTCCTACCAGGAGTCGGCCAAGTCACGCAAAGAACTGCTGGACACACGATCCGAGGC
      GGTGACGCGACTAATACGCAACCAGATCACCGACTATCACGTCCTGTGGTCGCAGGGCTCCAAGATGCTGTCACAGTATC
      GCGAGTGGAACGAGTTCCTCAACATATTCGGCCACGAGGCCGGCCAAAAGCTATTCCGGCGGCACATGAAGAAGCTGCGC
      GACGATCATCTGAACAAAAAACTGCATCAGTACTTGGATAAGTTTGCCCTGGCCCTGGAGTACCTGCTGCCGGACATCGG
      GGCTTTGAATATCAGCGATGACGATGCTTGGGAGTGCGCCAGGAACTATCTGCAGAATCACATCGAGTTCGAGCAGTACT
      TCTTCGAGTGCCCGCAGGCCTCGTGGACGGAGCTGGTGGACATGGACGAGGCGGAGGATGAGGCCCGCATTCCCTTTGAT
      GTGCTAGAGACTTCCGAGGCAGAGACTGTCTTCCGTAACTACTTGAACTCGGTGCAGCAGGACAAGAAAAAAATTGGATG
      GAAGCAGCAATTCAAAATGCTACTTGAGGAGTCGGGCTTTGTGACGCCCGGCAAGCAGCTGTCGGAGGTGCGCGTCCTCT
      TCATGGGACGCGAATGCTTTGAGGCGCTTTCGGAGCACGACTGCCAGCAGATCTACGACATTCACCAGGACGACATCATT
      GAAAAGAGCAAACAGAATTTTGTGGAGCTGCTGCTGGAACATGCTCAATATTTTCTACAGTTCAAGAACGTTGACAACAT
      CACTCAGGAAGATGTGCGCCAGATAACCGATGTCATACAGGAGGATTCACGCTACAAGATGCTCGATCGCTTGGACCAGG
      AGCGGCGGTTGATGCTTGTCCAGCACCTGCGCTTCATCCACTGCCCCATCCGCGATCACTGCCCATTCTTTTACAACTGT
      GTGGATAGCCTGATTGAGGAGGTGTTGTCCGACAAGTCGGCCAGCAACCACAAGACGCCCAGCGGCGGTGGCTGGAAGAG
      TTCCGGCAGCGGCAGTGACCGCACGCTCAATCTTCTGATCGTGGGCTCCGAGCACCTGGCCAGCGATCTGCTCAACGACA
      TCCGCATATGTACCGGTAGCAAGGGCGAGTACATCTACGAGAACCAGACGTATTATCTCAATTACCGAATCGCCAACGGC
      GACATGGAGGCCTTCAAGGCCATAGATGTCTACTCGAGTGGTCTTATTTGCGTGTACTCCAATCAGCAATCTTTTGAGAC
      GCTCAAGGATAACTTGGAGCGCACGTTGCTCTGCAACCTGGAGCTGGAGGACAAGTTCGAGAATCTGCCGATCGTGCTGG
      TTTACCAGCCACAGGATCTCAAGGAGAACGAGGTGGAATACTTGCGCAACGAGGGCATGCGCCTGTCGGAGATGCTGCAC
      TGCGACTTCATCGATCATACGCAAAATCATCAGAAGTATGTCTATGATATACTTAACATAGTCATCCTGTCGCTAAAGCT
      GACTGAGATGAAGAGCTACGAGCCGTATCCCTCCAATCACACCGACCTGCGCATCCTGTGCTGCATCTTTTGTGGCGATC
      AGTATGACATCGAGAACATTGTCCAGCCGCTGGTGGAGGAATCGACGCTGGTCAAGGCCAACGAGCACTCCATCATTGTC
      GACGTCTTTATTGGCGATGCCAAGCGACGGGTCGAGTTTATACTTTCCTCATATCATGGCACTAGCCAGTACCGCGATGA
      ACTAATCCATGGCTATATTTACTTTTACTCGACCAAGCGTCGATCTTCGTTGGCAAATCTAAGCATCCTGGCAGCCCAGA
      ATGCCAATATTCCATTGCAGATTATCGCGGTGACCGAGAGCGGGGGCGTTAATGCGTTCTTCAACAGCGATATTTGCCAG
      TTTCTGATCACCGAGGGCAATGCGGTGGCCGATCGCTTCAAGGGCAGCTTTATGACCTTCTCGGCGGATCAATATGTCAA
      GTTTGCGTTCTATAATCCATTCCTGAAGACAGCCTGGGACAACAAGTACGAGGTGGAGAACCTGCATGTGGAGGAGTCAA
      TTACTTTGGATTCGGGCGAGGGCACGCTGGAGAACTCGGTTAATCAGATGCCACGCCCGCCGCCGCGCCACGAGAGCTAC
      ATGCTGTCCAATACGCTGGGAACCGACGGTTCCGGCAGTGAGAATTACGAAATGGCTCCAACCCGATCTCTCAACTCATT
      AAATGAAGAAAGAGATATATCATTAGATGAAATCTACGATGACAACGAAAAGCCGAAGCACCTGCATCAAAGATTCCAGA
      TATTCCCTCCTCCAACAACTCCTCCAGAGCCAGCCCCTCCAGATCATCAGCTCATTACATGCACATATAAGAGTCAATTC
      GTTTCGGCTTCAGAATCAAGTTTGGAAGAAATAACATCGGATGTCAGCGGGTCCAAGGATTCACTGGCCACCCATGATGC
      AGAGTGGCTGGAGGACAAGAGCGATGGGCGACGCAACATGAACAAGAATTTGATTTGGAACAACTTCAGCGGATCCACAC
      ATGCCTACACCACCGGTCGCCGTCACATCGACTCCAATTTGAACAAAATCCGCCCGAAGGGACCCAGTCAAACGCTCAAA
      GTGGGCGAGGCGCCCAGTCGCAATTGCCCGGCCATGAGCTCCTCCACCTTCACCCTGCCCACGCAGCAGCCGGGCAAGCT
      GAACATGAAGAACTTCCAGCTGGTCAGCGATGCGGTGGCCAAGATGAATTTCACCGGCTCCGGTTCGGGTTCGGGTTCCG
      GCTCGGGATCGGGCAGCACTGGACTGGGCCTGGGTCTGGGCTCCGGCAGTGGCTGCATGGGTGATTCGTTTTTGGAGCCG
      GTCGACAAGGACGGCAAGCGCTACGATCATGCCCAATTGGATGGCGAGGATGAGGATTCCGAGGAGCTCGCCGAGTACGA
      GCAGATCTACGAAAATGAAGACTGCACCGAATCGGACAGCTGTGCCAGTTCCACGGAGCGACGGGTGCGCCAGCAGAATG
      CCTACTATAAGGCCAGCAAGAAGCCGGTGGCCGCCAAGAAGCAGAAAAAGAAGAAGGTGGCAATTCCGGTGCAGACACCG
      CGTGTTCCTCCGTTCGGCTCGTATGTGAGTCCGCCGGAGATTCCGCTGCACTACCAGCGCATGGCCGTTGGCGGCAGCGG
      GCCAGGTGAGAAAAAGAAACCAGAGCCATGTGTTCCCGAGTTCATGAAGAGTGACAAGTCGCCAGAGTATTCCATGGTGC
      CAGAACTGGCGGGTGCCGGCATCTTCGGTGCAGAGAATCTGCCCGAGTACAACATGAACCAGGCCAAATGCTTGAAGGAC
      TTTGAGAAGCTGGAGAAGCGGCGCATCAAAGAGGAAACGGCCAGGCAGCGCAAACTACAGGAGAAGGAGAAGGAGCAAGA
      GAAGAAGCTCAAGCGCAAACTAAAGCAGAATGCCAAGGGCCTGGTTGAATCCGCGGAGGCGCAATTCGGCAAGCTGATGA
      TTACCTCCGAGCAAGGCGAGATCCCCATCTTCCTCAACAAGTGCGTCGAGTTTATCGAGAAGGAGGGCCTCGACTCCGAG
      GGCATTTATAGGGTGCCCGGAAGTAGGGCGCATGTCGACATGTTGTTCCAACGCTTCGAAGAGGATACCAATACTGAGAT
      TGATGCGCTCGACATTCCCGTCAATGCCGTGGCCACGGCACTGAAGGACTTCTTCTCCAAGCGCCTGCCTCCGCTGTTCA
      GCAAGGACATCATCAAGGAGCTGGAGGAGATTGCCGGCTCGCGAGGCGTCGGCAATTCCAAACTGAATGTGGAGGTCAAA
      ACGGACCGAAGTTGCCGCTTGATAGCTTTAAAATCGCTGCTCCAGAAGCTGCCGCCCATCAACTTTGCCATACTCAAATA
      CATATTCCAACACTTTGTGCACGTATCAGACAATTCGAAGCTGAATAGCATGGACAGCAAGAACTTGGCCATTTGCTGGT
      GGCCGACACTCATACCCATCGACTTCACCGACATGGGCCACTTCGAGCAGCTGCGTCCGTATCTGGAGGACATTGTCCAG
      ACAATGATTGACCAGTTCCCGTATCTGTTCTGCGGCAAGGATGCTTTTGTCATGGTCTAGGCCTAGATCCCCGCCAGGCC
      ATGGCACACTTGGACTTCTACTTGACCGCCGGACGCGAAGCCAAAACGAGATAGTTAGATTCAATGTGCGTTTGTGTATG
      AATGTGGGCCATGTGCCAGTGCCATGTGTGCCATGTGTGCTTTGTGTTTTTTGGGTGAACTAAGGAGCATATTAGTAATA
      GCCATAGAGAGAAGATAGCAGGAGGAAGCTGGAGGAGGCAGGAGGCGTTAGCAGGAGGCAGCCCATCGATCGATCGATTC
      ATTCAAATGAGGATCAGCAGCCAGGCATATACATATTTATAATAGTATATAATATACTTGGGTCTATTGTGTGCAGTGTG
      TGATTAGTGATTCCTGATTGTGTGTGCGAGCGAGACAACAGAACTTGGCTAAGTAGGGTATATTTATTTTTTATATATAC
      AATATATATTTTGTATCGATGGCTTTGTTGTGTTTCCGTGATATATGTAAACGCGTCAAGTATTTTCTCTGTGTGGTGGT
      GCGTCCCCCTTGTCGTTGAATCCATTGAGTGAGACCTCCCCTCGCCGCCCCCCACTCCCCGCCCCTCGGCCACCGCCAGT
      CTACTCCTCCTCCTCCTCCTCCTCCCCTGCCATCCGCCACCCACAAACGCTCCACCCATCTCGAGGGGCGGGGCGGGGGC
      GCCAACGACAAACGCACAACAGCAAGAACAAGAAAATGACTAAAAACTAAAACAAAACAAAAAAAGAAAAATAAGAGAAA
      AAGAAAACCAAGCGATATATATGTGAAAGCATGGGGAGATATCTAGTAGGATGTCAGCAGGAAGATGGTTAAATAAAATT
      TACTGTGTATCTGTGTATGTTATAAATGTAATTGTAATTGTGTGTTTAAAATAATGCGCGATCAGCCAACAAATTTTCAC
      ATATGTAAACACAATAGCGATAATGCTAGATATATGATATATATATATATATTTAAATACCACTAAATGTCTGTGTGTCT
      AGTATAGGAGAAAGTAGGAGAGGTGGAGCCGTAGGAGCAGGGGGAGGGGGAGAGAAAGGATGAGCGAAGCGAAGTAAGGA
      ATACACTATAAACAAAATGCAAAAAAAAAGCAACCAATAAGAACAACAGAGCAAAATCTAATTTTCGAGCTAAACTAAAT
      GTGCATCTCAGTGTGTGTGTCTGTCTGTATATGTATGTTTGTCATCCAACTAGATATACACTATATAATTATATAGCTAC
      CATATAAGCAAAAAATGATAATTACTGCGGCAAAGGAAATCTCCCACAAAAACTACAAATAAAGTTAATAATAAAAACTA
      AAAACAAAAAACAAATATACAAAGCGAGCGAAGTGAAATAAAACTCAACTTTCCCCCACACTCGAAACTCCGATGATTGT
      CTAATTGATATTTGCATTAGCCAGGCATATAATCCTTAATGTAATACTCTCTATCTGTCTCTCAAAAAACCAAAACCAAA
      TTCTGTGTGTGTGTGTGTATGTGTGTGTGTGTGTGTGTACCGTATCGAATTAGTGAAAAACAACAACAAATTATACAATT
      TCTAACCATGTACGCATATATTTTAACTAAAACCAGCGAGCAGCAGATTTTCCACAAACGCAATTTCCACAGGCAGAAGG
      AACGACTAAAAAATGCAAAATGCAAATCGTAAACAATTGTAGACAACATACGCCTAAGTGTTATTCCTTGTAATTGAGTA
      TTAATTTTTTATATACAAACCGAAACCTAATTACATACATATATAATTGTGTATCTTGTGTCTGAAACGGACCTCAAACT
      CAAAGCAAGAAAATAACGCGAGATCTGTTGCCAAACAAAAGAAAACAAAACAAAATAAAAACAGAAGAAATAAGCACTCC
      AAATGAAATTTACAACAAATAACGAGAGAAAAAGAAAAGAACAGAAAAACTTAACCATTATATAGTATAATTTGTATAGA
      TGTGTGTCTATTGCATTATTTGTACACGTACATATATACGCTAAACTGAAACAAAAACATAAAACATTGAAAAAAAAAAC
      AAGCAAATATGTCTAAACGAAACGAAACAAAGCAAAAAAAAAAGCAAAACAAATCGAACAAAAAAAATTGTAATTGACGT
      GATGTGTAATGATATTTTTAAAAGCAAATTTTATGCCACGCCCATGCCACGCAGCCACGCCCCCTTTTCAAACCGAAAAG
      AAGTCTCCTCCCTCTCCCCATCAAAAACCAAACCCTTCCCGCGCAGAATCCAGCGAATCCCCGTACCGCCACCCCCGTCC
      GAACTCCACCACTCACATCCACGTTGCGGATTCTGGATGCCGGATACGCCAAGTCAGATGGGTGACCACCGCTCCTGGGC
      TCCATCCGATGGGCTGGTAGCGGTGTGGAGCCGCCACAACCGAAAGACGAGGAAAAACATAATGAAATCAAATCAAACGA
      AACAAAAGTAATAAATTTGTGGGCATTTTCCAAATATTTGTGAAGCATTTG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0074483
      7348
      FBtr0074481
      5872
      FBtr0074482
      7639
      FBtr0333659
      7301
      FBtr0333660
      7693
      FBtr0333662
      6742
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0305817
      1621
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0074257
      1561
      FBpp0074255
      1561
      FBpp0074256
      1561
      FBpp0305815
      1564
      FBpp0305816
      1579
      FBpp0305818
      1398
      Comments

      Extended 3' UTR based on RNA-Seq and/or EST data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      RhoGAPp190-RF
      Secondary FlyBase IDs
        References (0)