Open Close
General Information
Symbol
Dmel\Ptth-RE
Species
D. melanogaster
Annotation Symbol
CG13687-RE
FlyBase ID
FBtr0333746
Feature type
Associated gene
Evidence Rank
Length (nt)
673
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        AGCGCTGGTCAGGCACAGATCGAGCATGATGCCGTGGTTGCCCATTTCCATTATGGCAATGGCGCTGCTTAGCCTGACAA
        ATAAAGGAATCGCCAGTCAGTACGCCAGCGATGAAGGTTTGGACGAGATGGTGGGTCTAAGGAGTCTGGAACACCGCGCG
        GAGGAGCAGCAGCCCGATCGCAGTACATCGAAAATGCTCAGTGCCCTATTCGGATTCAGTCCCAGCACTCCACATCCCAC
        AGAGATGGCGATGGTCATGCCCCATCAGCTGCCGCCCATGTACTATAACGATTTCTATGAGGATCTGGTGACCACCAAAC
        GCAATGATGTCCATTCCGCAGGCTGCGACTGCAAAGTTACGAATGAGCTCGTGGATCTGGGTGGTCTGCACTTCCCTCGC
        TTTCTGATGAATGCCGTTTGCGAATCGGGCGCTGGTCGGGATCTGGCCAAGTGCTCGCATGGATCCAATTGCAGGCCACT
        GGAATATAAGGTAAAGGTCCTGGCACAGACCTCTCAGTCCGATCACCCCTATTCGTGGATGAACAAGGATCAACCTTGGC
        AGTTCAAAACGGTCACCGTAACTGCCGGCTGCTTCTGCACAAAGTGATTGAAAGGATGTGAGCAACTATCGTGAATGTGA
        ATTAATTGTATATTAAAGCGCCAAAAAGACGTC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0346650
        1019
        FBtr0346726
        782
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305888
        192
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0312235
        218
        FBpp0312335
        184
        Comments

        Downstream translation start supported by comparative analysis across Drosophila species.

        Transcript terminates at site supported by polyadenylated cDNA.

        5' UTR based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Ptth-RE
        Secondary FlyBase IDs
          References (0)