Open Close
General Information
Symbol
Dmel\Usp1-RE
Species
D. melanogaster
Annotation Symbol
CG15817-RE
FlyBase ID
FBtr0333818
Feature type
Associated gene
Evidence Rank
Length (nt)
4844
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 24 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CATCGATTATTTCTCTTGCATCCCTAGTCGTCCGCTCCAATATAATAATTTCACTAGGCAACCTTAATGTAATAAGCGAC
        GTAAAACCGGGACTAAATAGCTCCAGAGCGAATGCTTATTGGCTACCAGCGAGTTTGGCCGTCGTGCGTGCGATAGAATC
        CGATAAATGGCCGCAAACCGGGCAGCTGCGGCGTTCTATAACTTTTTCTCCGATCCGCATAGCGCAGCATTGCCCACAAA
        TGTTGCTCCCCCAATATGATAATGAAAGATGCACGAATATGACGTAAATGAGCGCAAAGAGGAACCAGCCAGTCTTCCAC
        CCACACAAAACGAGACCACTGAAATCAACAGCCAGCTACGACAGGATCAGCAAAATCAGGAACAGGAGAATCCCCTACGG
        CAGCAGGATAACAGCCACCCGCCTCAGGAAAATCCAATTAATCAGCAGGAGAAGGACACATTGCAAGTTTCCGTTCTTTA
        TCCTCTGGTAGTCTGCGCGCAGCTGGCGGACAGTCAACTGGTTCTGACTGCGGACACGCCGAAGCTATCTCCAGTTAAAA
        AGCGTCAGCGGCGCGTTTATGTTGCGGACACCTTGCGCTGCTACAGTCTACGTTCCCGGCAAGAGCCCGCGACCAAGGAC
        CCACTCGAAGGTGGCCTAAAGCAGCCGGACGTCGTTCCACCACCCCCGCCTGTCCAGGCGCCCTCTCCCACGCCCACAGA
        GTCCACAGAATACACACCTCCAGAACAATTTAAATCGGAGTTTTGGAACAGAATTGAAGAGGCTCAAGAGCCAAAGCCTG
        TTGGAAAGAAGCGACGAACCCCTGGAGGACTCAAAAGAACGCGGGGCAACAAGCTTCTAAAAGAGCTCGAGATCCAATCG
        CCGGAAACGGCGGCCGCTATTGCGGCAGCACAGGCGGAACTCAACGCCGCAGGAAAGTCGGGAGCAGCAGGAGCACGGTC
        CAGCCGCAAGAGGACCAACACGATGTCTCTATACGATCGGCGATTCCAGACGACCACCGAGGAGCGCCGCGTGGCTAACG
        GATACGGTGGCAATGCTGCGCGATCGGTCACTGGCTCCTCGTCAAACGAGATCGAGTCCCAGGAGCCGCAGAGTCATCAG
        TATTACGGTCCCAATGGCGGCAGCAATGCCGCGGGAGCAGGCGCAGGCTTGAACGGAAGTGCGGCGGCCCTGAACCATGC
        CCCTTCCATGGGCACACTGTGCAACATTGGCAACAGTTGCTACTTGAATTCTGTGGTTTACACCCTGCGCTTTGCCCCGC
        ACTTTTTGCACAACCTACACCACCTGATACAGGACTTGAATGTTGTGCAGCAGACGATAGTTCGCCAACAAACGGCCAGG
        TCTGCGTCCCTCGGCAAAAATGTGAGTGCCGCTCAGTTGGAGCACGCCCGCAGCTGGAGCAGCAAGGATCTGGCCACCAG
        TACGGATCAGTACAGTGGCCAGAATGGCGGAGTTAATAGCGGAAACGGTGGTAGCGGCTCGAGCAAGTCGACTCATCAGT
        CGGTAACCGAAAAACTCCATGAACTGTATAACAACCTGCACGGCAACGAGATGGCAGACTCCACGGAGCCCTACCACGCG
        GACACGCTGCTGCACGCCATTCAGGACGTAAACGCCACCTTTGAAGGTAACCAGCAGCAGGACGCACACGAATTCCTAAT
        GTGCGTGCTTAATTGCATCAGGGAAACGAATCAGTCTTTGATCAAGGCCATTGGCGAGTGTCCTGAGGTCATCGCAAATG
        GATACATAGCCAACCCGGATGAGGTCGACACCGGAGAGGGACAGGATCGCACTGATTCGACTGCGTCGCAGAACCTGAAC
        GCTGGCAATGGATCGCTGGCAACTAGTCAAACAACCACGACCAAAACGTCGTTCTTCTCTCGCAAATCAAAAAGAAAAGA
        CGAGGTCAAGCCATCCAAGTCGACGCGCGTTCAGTCGCCACTCAAGGAGAATAGTCCCACGGCGGGCGGGATAACCGGTG
        CGGGCACAGCCCATGCCACCGCCAACAGCCTGTTCTACCTGAACACAGTTGATCTCAGCGGCGCCAGCAGCACCAGCGGT
        AGTGCCAGTACGAGTGCCAGTGGCGTTGTTTCCACAAGTGCAGCGTTGCCCACACCCCCGCAGGCTACAAAATACTCCAG
        TGACGACGAGATGAATTCCGCCACCGTGCTGAAGGACAAAATGCGACTGGAGGAGCGAATACGGGAGCTCAATCTAAACT
        TCTTCAGCTCGGACTTCGAAGGCATTGTGGTGCTGACCACCAAGTGCCTCAGTTGCGAGACGATAACGCGGCAAAAGCAG
        GGCATGCTTGATATTTCTGTGCCGGTGCCGATCTCGGGGTACGACAATGCTGATCTCCAAGACAAACCGAGCACCTACAT
        ACAGAATTCCTGCATTACGAAAGAGTATTTCCGCGGGGAGAATAAGTATAGTTGCAACCAGTGCACCGGCTACACCGAAG
        CCATCCGCTCCATCTCGTACGAGGTGCTGCCGCGGTTACTGGTCATTCAGCTGAATCGCTTCTCTGGCGGCATGGAGAAA
        GTGAGTACGTACGTGCCGACCACCTTCACTCTGCCCTGTTTCTGCGCCACCTGCTGTGAGCTGGGCGAGGGCAACAAGCT
        GCACGTTTACAAGCTGTACAGCGTGATCACGCATGTGGGAGCCACCCTGACGGTGGGCCACTACATCGCCTATACGTGCT
        TCTTGGATCTCGCCAGTGACTATGTCAACTGCCCTAAGGATCGCAGGAATACGATGACGAACTCGCAAACGATGGCTTCG
        CAAGCAGTGCCCTCCAATGAGAATGCTGCGCCAAACAATGGTAGCAGCTCCGTGGCCAGCACTCCAGTTATTGCAGCAGC
        TTCGGCATTGGCCTCATCGGGCAACATTTTGATGAAGAAGATGAAGTTCGGTCGCAGCAAGGCCTCCAGCAGTGGTGATA
        TGAGCAAGAACGTTAAGCAGGTTAATGGGATAATCAGCAAGAACATCACCAATGGAATTGGCAAGCTGAGCATAAGCACC
        ACCTGCCAAGGAGTCAACTGCTGTGCCATGAGGCTGTGTTGCACCCAGCAGACGAGCAGCAGCAACTCGACCAGTTGCAG
        TGATTTCAGCGAGGAGTCCCTGCAAAACGGAAGCAACAGCAATCTCAGCTTCGGAGGATCGGGCAGCACCTATCCCACGG
        GCTACGGAAGCACGGGTCGCGGTGGTGTCAGAGCCAACTACGCCCACGGAGGTCCTGATCCCATTTGGTATATGTGCGAC
        GACGACAAGATCAAGGCGATGACCCAAAGGGAGTTCGAAGAGCTGCTATCGCCCACACGGAAGATCACAATAACGCCGTA
        TTTGCTCTTTTACGCGCGATTCGATCTGCAGCCGCAGAAGGCGACGCCGCCGATGCCTGGATCATCCACAACGCCTCCGC
        CACCGTCGTCGGCACAGAGTTCGTGGTCGAATGAAAACGTGTCCAGCGGCTCGCACAAAATTTGAGGTTGCCCCAAATCG
        CAAAAGCCCAGTGGCAAGCGGGGAAAGTAAAAATTTATTGAAAAAGTGTACATCGGACATACTGATCGGATTGGAGATGT
        CTCTAGACTAGAATAATAAGCAAAAAATGAAGTCTGTTTGTTAAACAATGTAATCGTACTAAGCTCTATCGTTTATCTAC
        ATGCATAACTATTCATGAACCGACCAGTGGTTTGACTGAGTCCTCCCTTTTCCCATATCCAAAAATCATATAGTTTTTGT
        TTTTATTAGTAGCAATCAGTTCTGTTTGTTCAATCGATGCATTTGATTTTGGCATTCTATTATTGTATTCTAATCGTTAT
        TAATTAAAAAACCGAAAGCGTCACATTGAAAACACGAATTTAAAACGTTGAGATTGTTTGCCCCGTTGAATGTAAGTGAC
        ATTCGCAGAACGTTTTCGATATACTCCTACATAAATTTTGAAGTGAAAGCAATGAAATTAACAAGTCTTTGATTCGAAAT
        ATTGCATGGCAGGTGGAGCGAGTGTTGTAATGATAGTAATTATTAATAATAGTAATGAATAATCTCCAATATTCTCATAG
        GACACACCTACCCAGTTGGCTTTGTGTCCGGCAGGCGATGGAATCTGTAATAATTACAGCATCAGTTATACTTATAGTGA
        CTGGAATGGTTTATTGTAAACAATGAGCTATACCAACGCAAACACACAAATCTATATACGAAGTGTTGAATAGTTGTTAA
        ACTCATGACACACCTCAAAAGTGAAGTGAGTGCAATGTAATATTGTAATTGATTGAATCGAAAGTGGCGGACAAACAGAA
        ACAGATCAAGCGAACAACTGAGAATTGTTATGAAATGGATTGCATAGTTTATAGAAACGTTTTCATGTAACAAGCTGCAA
        CAGAACTTCATTCACTCACAAATCACACACGTTTGTAATGTAATATTGATAAATAAATGTAATAAAATTATAATATATCT
        GTAATAATTGTAACAGCACACTACTTACGCAATAATTTTAGTTTAGTCGTTTAGCCTTAGTTTCTCTCTCCATGCATTAC
        ATGACTCTAGTTTAGTTCAGTTCTATTTTTTTCCAAGAGCGCTGCTATAGTGATATTAACATTTACAGAGCAAAGATTTG
        TGTACATTGTAATTTGTAAAGTTTACATATAACAATTGAAAATAAATTTAACACTGATCAACATAAGCATGCGATTCGAC
        AGTTTAAAGTGACACATAAATTGAGGACCGCTCGATTCCAATTACATTTATGTTTATTATTGATTAGCATTATAGAACAT
        GCTTAACTAAATATACGAAATATACAACATACATATAATCATGG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0300832
        4704
        FBtr0300833
        4864
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305952
        1078
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0290056
        1078
        FBpp0290057
        1078
        Comments

        Extended 3' UTR based on RNA-Seq and/or EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG15817-RE
        Usp1-RE
        Secondary FlyBase IDs
          References (0)