Open Close
General Information
Symbol
Dmel\Rbp-RI
Species
D. melanogaster
Annotation Symbol
CG43073-RI
FlyBase ID
FBtr0333832
Feature type
Associated gene
Evidence Rank
Length (nt)
6581
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 16 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CACTCTGCTCTGGCACACTGAGCACCGAGCTGGCAGTTGGGTAGAAATCAGAGTGCGCCAGCAGCGCGACCGAGATGACC
        CACTTTTCGGTATTCGCACTGAGACCCAACTGCTACTACCCACAGAAAGTGGACAACTAGGCGGAGTTTTTTTCTATATA
        GTAGCAGTGAAACGATCGCGTTTTTCGGATATATTATGTACAGCCTACGTAGCCTAGTGTAAACTATATGCATTTATGTG
        AATTTCCCAGCGCAAACGTGGAAGAGGAAAACAGGCGACCTGAAAAAGCAGCAGCAGCAGCAAGCAAGAAGCAGAAGCAC
        AAGCAGCAAAAAAGGTTCGCAACCCGTTCAAAAGCCCCCGAATACAAAATATTACAAAAAGTTAACCCAAAAAGAAAGGA
        TAAAATCCTGTGCTTCCGAAAACGAAAACCGCAGTTTAAGCAAAAAGTGTCAAAATCGCGTGGTAAATACTTATTTTGCG
        CAAGCTGAAAAAAAGAGCTGTTATGCGAGCGAGCGAGCTCACGAAAAATTTCGCTGTACACCAAATGTTTGCCCAACAGC
        ACCGCTGCTGCGTGAAAATTTCATTTTCTCGCCAATAACGTGAAAAAGCTCGCCGCGAGTGCAGTTAAAAAATCCAGTGA
        AAGATATAATGATTCCGGGAAAATGGTGGGACAGTGAAAAGTAAAAGTGTAAGCATATCGATAAAGGCAAAAAAAAAAAA
        AAAATACGAAAAAGAGCAGCCAGCGTAAAACTACACTCTCCCACACACACTCACATGCATACATATATCCAAACATATAC
        ATATACATACTCGCCCACATGCTGATGCATATACAATATGCAAATGCGGGTAATCACTGTAAAACCGAGGCAGGCGAAAT
        GGTGAATGAAACCGAAATTATAGAAAAATGCCTAAATAAAATCGGAGAAATTGGCTAAAAGCAGAGTTCAGCTACATTTT
        GGCACAAAAAAGCGCGCACCCACACACACTCACGCATACACCCGCCACACACATACAGAGAAAGCGAAAAGAGCGAGAGG
        CATTCGTCCGAGGGGCAGCCACAGCATGCCGTACGAGTCGATGCACCATCATCAGTCGGCGGCCGCTGCCGTGGCCGCTG
        GCACCACCCCCAACGGAATGCTGGACGCCCTCAGCCTGCAGCTGCGCGATGCCGAGATGCGGCGCACGGAGATCGAGCGG
        GCGCATCAGGAAACCCTGGCACAAATACGCAATCTGAGCGGTAGCGCTCGTCCCGATGCCGAGGCGGTGGAGAATCTGCA
        GTCGAGAGCCCGGGAACTGGAAAAGAAGGTTGCGCTGGAAAATGTGCGCTGCGAGGAGCTGCAAATCGAACTGACGTCGG
        CTCTGAAGGCCAAACAGGCATCCCGCTCGGCCTGCTCCGGAATGGGGAGCGTGTCCTCCGGTGGCGGCGCGACCATTCCT
        ACATCGGCCAGCAGCTCCACCGTCACTTGGGCACCGACAATCAGCCACCAGGACCAAGGATCCGAGATTGATATCATAAT
        GGCAAAGATTGAGCAGGATAATCGCGTGCTGGCCGAGCTGGAACAACCTCGCACCTCGGCCAGCGCCAGCATGTCAGCAT
        TGCCGCCCAGTTCCATGTTGAGCACGGTAAATAGCGAATTTAGAACCATATCAAAGAGTGAACTCGAAGAAGAACTGAAC
        CGCTACAAAAGAGCAGTTCTGGGAGGAAGCGGAGGAGGAGGAGGTGGCGTCGGCGGCGGCGGCGGCGGTGTCTCCGCCCT
        ATCCTCCGGCTACTCAAGCCTGCCGCAATCGCTGGCCTCCACGCTGCCCAATGGTGGGGCCAGCACCAGCTTGAGCGGCA
        CCAGTCTTGGCTCGCACAGCGCGGCCGCCGCTGCTGCCGCCCACAGCGTCTCCGCTGGATCGGGAGGCGTGGTCGGGGGC
        GGCGGCCAAGGCGGCCTATCATCCATATCGGCCCTGGTGCCCAACTCAATCAGCGGCATATCCTCGAGTCTAAGCAGCCA
        TGCCATTCAATCGATGCAGTACGGAACCGGACAGACGTCCGTGGAGAAACTGCTGAGCGGAACTAGTGGAATCACTGGCA
        TTCCACCCCTGCCGGTAAATATTCACACGATGAAGGCTATGCCAACGGCATTAAGTCAGCGCGGAACAATACAGCTGTAC
        AATTTGCAGAGCACAACCATGCCCCTCCTGTCACTCAACTCGCATAACCTGCCGCCCGCCGGCTCGACCAGCTACTCAGC
        TTTGGGCGCCGGTGGCGGCACCTCGCTGACGCACCCGACCATGGCCAATCTGGGCCTGCTGGACACCGGCACCCTACTGG
        GTTCCACCGGCTTGAGCGGATTGGGCGTGGGACCAAGTGTTGGCGGCATCACTGGAGCCACATCTCTGTACGGCCTAAGC
        GGTGGCGGCGGAGGAGCCGGTGGTCTGGGCAGCTCCTATGGTCCGCCGTTCCTGGACGTGGCGTCGAGCGCCTCGTATCC
        ATTCACCGCGGCCGCCCTGCGACAGGCTTCCAAAATGAAAATGCTGGACGAGATTGACATACCGCTGACGCGGTACAACC
        GCAGCTCGCCCTGCTCACCCATTCCGCCGAACAACTGGGGACTGGACGAGTTCACCGACGGCCTCAGTGTCTCCATGATG
        CATAACCGCGGCGGTCTGGCACTGGGTGCCCTAGATTTGGACACTCGCAATCATGGCCTAAATGGAGCCAGTGAACCGCA
        GGTGGATATGCTCGATATTCCTGGAAAGGGCCGCTGCTGCGTATTCATAGCCAGATTTCCCTATGATCCTCCAGATGTTC
        ATAATGAATTCCTTTCCATGCCTTGCAGGGAGGCTGAGGGCGAGCTCTCCCTGTGCGCCGGCGACTATCTGCTGGTGTGG
        ACCAGTGGTGAGCCCCAAGGTGGCTACCTAGATGCGGAGCTGCTGGACGGGCGACGCGGCCTTGTTCCTGCCTCCTTTGT
        GCAACGCTTAGTAGGCGACGACCTCCTGGAGTTCCACCAGGCGGTGCTGTCGACGCTGCGCGATGCCGAGGACGGATCGA
        TGCAGTGCGACACCACGTCGCTGCCCTCCTTGCCACCGCACAACCCATTGCTCACACACACCCACGAGGATCTGGCACGC
        TTAAGTGAGACGCACACCGATCTGGAGCACGACCAGGACGACATCAGCGACAATGCACCCAAGCACTTGACGCTGGAACG
        GCAGCTGAACAAGAGCGTGCTCATTGGCTGGTCGCCGCCGGAGCCAGTGGGCTACAACCTCATCGACAGCTACCACGTCT
        ACGTGGACGGCGTGCTCAAGGTCACCGTGAAGGCCAACGAACGCACACGCGCGCTTATCGAGGGCGTTGACTCCACGCGG
        CCGCATCGCATCAGCGTGCGGAGCGTAACCCAGAACCGACAGACATCGCGGGATGCCGCCTGCACGATGATCATCGGGCG
        GGACACCGCTCATCTGGGCCCCTCGGCGGTGCGCGCCTCGCACATAACTTGTTCCTCGGCGGTCATCTCGTGGCTGCCGG
        CCAACTCGAACCACCAGCACGTGGTGTGTGTAAACAATGTGGAGGTGCGCACCGTCAAGCCGGGCATGTATAGGCATACA
        ATCACTGGCCTGGCGCCGAGCACCCAGTACCGGGTGACGGTGCGGGCCAAGCATCTGCGGGCCGTGGGCCAGCATGCGGC
        GAATGTGGGCCAAACGGGCGGAGCTGGGCGGCCGGGACAGGAGGAGGCGCCCGGAGCGTATGCTGACTTCCGCACCCTCA
        CCAAGGGCCTGCCCGATCCGCCGCAGGAGATTCAGCTAGAGGCCGGTCCGCAGGATGGTACCATTCTGGTGACATGGCAG
        CCGGTTAACAGGCCCACCTCGACGGGGCCTGTAACCGGCTATGCTGTGTACGCCGATGGTAAGAAGGTCACCGACATTAA
        CTCGCCCACCGGCGACCACGCCCTCATCGACATTGGCAAGCTGGGCGTCTTCAATCCGCGTGCCGTGACCATACGCACCA
        AGTCCCGCGATTCCCAGTCGGCGGACAGTGCGCCCATCTTGATACCAAACACTGTGCGCAATGCGGTGGCTCGCAGGGGT
        CCCAATCAGATGGGCATGGGTCCGCAATTGCCGCAGGGACCGCACGGGATGACGGTGCAGCAGCAGATGGGCGGCATGCC
        CGGCCAGCCGGGTCAACAGGGCCAGCACATGATGGGTGGGCAGCAGGATCACGGCCAGTACGATCCCAATCAGATGCAGC
        AGCAGCAACAGCAGCAGGGTCAGCCGGGTCAACCGGGTCATCAGCCCGACGCAGGCTCCGGATTGTTAGGTGGCCTTCTC
        GGTGGCCTCTTCTCGAAACCCACACAGAATCAAGTGAACCAGAATGGCTATCAGCCAGGCCAACCAGGAGCGCAACGGGG
        CATGGTCCCGATTCCAGGAAGACCGCAGGGACCACAGCAACAGCAGCAGCAGCCCTACGGACCCCAGGGTCCCATGGGTG
        GGCCACGCTTTCGAGGACCAGTTCCCGGCCAGCTTAATATGCAGGGCCAGCAGATGCAGGGGCAAATGCAAGGGCAGATG
        CAAGGGCAGATGCAGGGTCAGATGTCGGGTCAGATGCCCGGTCAAATGCCTGGACAAATGCCTGGTCAAATGCCAGGTCA
        GATGGCTGGACAAATGGCTGGTCAGATGCCTGGCCAGATGCCAGGTCAAATGCCCGGTCAGATGTCCGGTCAGATGCCTG
        GCCAGATGATGGGACCACGAGGACCGCTCAATCAGCAGCAACAGCAGCAGCAGCAGATGCAGCAGGGCCAGATGATGCCC
        GGCCAGCAGGCAGGACAGCAGCAGGCCCAGCCCGGTCAACCGGGACAACCGGGTCAGATGCCCGGAGCACAGAAGAAGCC
        CCGCTATTTTGTGGCCATGTTCGACTACGACCCATCCACGATGAGTCCAAATCCCGATGGCTGCGACGAAGAGCTGCCCT
        TCCAGGAGGGCGACACGATCAAGGTATTTGGTGATAAGGATGCGGATGGCTTCTACTGGGGCGAGTTACGTGGCCGCCGA
        GGCTATGTGCCGCACAACATGGTCTCCGAGGTGGAGGACACCACCGCCTCCATGACTGCCGGTGGACAGATGCCCGGTCA
        AATGCCGGGCCAGATGGGCCAGGGCCAGGGAGTCGGCGTGGGCGGCACCGCCCAGGTGATGCCCGGCCAAGGTGCTCCGC
        AGCAGAGCATGCGCAACGTGAGCCGCGACCGCTGGGGTGACATCTATGCCAACATGCCCGTGAAGCGAATGATCGCGCTC
        TACGACTACGATCCCCAGGAGTTGAGTCCCAATGTGGATGCCGAGCAGGTGGAATTGTGTTTCAAGACGGGCGAAATCAT
        ACTCGTCTACGGTGATATGGATGAAGACGGTTTCTACATGGGCGAACTGGACGGCGTGCGCGGCCTGGTGCCGTCTAACT
        TCCTGGCGGACGCGCCCGACCAGTACAACAACCAGATGGGTCCGGGCGGAGTGGCCGGCCGCGGCGGTCTGAGCCAACGG
        GGCAGGGGTCAGGGGCCAGGAGCGAGGGGGCCGCCGCCCCCGCCACGTGACAACATGATGCCCGGAATGGGCGGGCGCGG
        CCAGCCGGGCAAAAATGCTCGCCCTGCTTCCCCTACACTGTTAGACAACACGGGCCATCCTGCCCCCGATCACCAAACGC
        AGGGGATGATCGGTCGCGTTGGTAATGTTGGCCTGCAGCAGCAACAGCAACAGCAGCAGCAGCAGCAGCAACTCCAACAG
        CAGCAGCAGTACGGTCAGCAACAGACGCAGATGGGACAGCAGCAGCAGCAACAGCAGCAAATGGGACAACCTGGAATGAT
        GGGTCAGCAAATGGGTCAGCCGATGGGTCAGCAAATGGGACAGATGGGTCAAATGGGTCAGATGGGTCAGCAGCAGATGG
        GACAGCAGCAGATGGGACAGCAGCAGCAGCCGCCGACGACACAGGCGCAAACGGGCGGACTATTCTCCGGCGCGACTAGC
        CTGCTCTCTGGTGCTACCTCGGCTGCCACCGGTGGTCTATTTGGGTCGAAGCAACCGCCCAAGACGGATCCAATGCAACC
        ACAAGGTGGTGTGCAGCCAGCGCAGCAACAAGCAAACGCCTTTGGTGCCCAGCAGCCTGGCATGGGCATGCAGCAGCAGG
        GGGGAATGCAGTCCGGAATGCAGCAGGGCATGCAGCAGGGCATGCAGCAGGGTATGCAGCAAGGGATGCAGCAAGGGATG
        CAGCAGGGGATGCAGCAGGGCATGCAGCAGGGTATGCAGCCCGGAATGCAGCAGCAGCAGCAGCAGCCACAACAAGTGCC
        ACCGCAAGCCCAGGCGCCGCCTCCAGGACCGGGCGCCGGATTGCTGGGCGGGCTCAAGGGCATCGCGGCAGCGGCGCCCG
        GCGGCGATGTCCTGTCGAAAGGCAAAGACCTCTTCGGAAAATTCGGGTTCGGCTTTGGCAAATAACCCCGGTCATTCTAT
        AGGGTCCTGTTATATTATTCGTAGATTAGTCTTATTATTACTATTATGATTATGATTATTGCTATTGATTACGATTACTA
        AGCTAATATAAAGTAAAACAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0304826
        8410
        FBtr0304827
        5797
        FBtr0333833
        6118
        FBtr0433493
        8251
        FBtr0433494
        6405
        FBtr0433495
        8302
        FBtr0433496
        5848
        FBtr0433497
        5654
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0305966
        1799
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0293366
        1844
        FBpp0293367
        1817
        FBpp0305967
        1763
        FBpp0390599
        1748
        FBpp0390600
        1487
        FBpp0390601
        1765
        FBpp0390602
        1791
        FBpp0390603
        1473
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Transcriptional initiation is supported by short-capped RNA data (FBrf0209722) and RAMPAGE TSS data (FBrf0220331).

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Rbp-RI
        Secondary FlyBase IDs
          References (0)