Open Close
General Information
Symbol
Dmel\RhoGEF3-RM
Species
D. melanogaster
Annotation Symbol
CG43976-RM
FlyBase ID
FBtr0333962
Feature type
Associated gene
Evidence Rank
Length (nt)
12307
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 67 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TAATGGACGGAAGGTTTGAATATCGCTTCTCGCCCCAGTTGTACAGATAAAGTCCCACTGCACGCAATAGGGCACTTGGA
        AGATACAATAGAACGCCGAGCAGTGTGTGTATATAGGTTTGAATGCTTACGATTGGGAATAAGTGGCAAAATATTGCAAC
        TATGACCTAAACGCAAGGCAGTTAATAACTTCGCCAGCTTTTGGCCAGATTCGTGACACACTTAACTTGAAACTTCAATG
        CTAGTGGGATGGATATCTACTCTCAAGCCGTGTTTTAATGCCCCAAGGATTCCGCTTTCTTGCCACAGACAATGAGCAGA
        TTTGCATGTAATCTATAAATAATGGCAACTGAAACCTTTTTGGATCTGAATTATGAGAGGGGCAAGGTGTCGAAGAGGTC
        ACTGCGACCAAAGCTATTAAAATTGACAGATGTGACGATACCACATCGAAGTCGGAAGAAAAACAAAGTTAAGACCAAAG
        ACCGATCAGCCACATCCGTGCGCGACAGGATCTATGATGATCCTGCCTACACAGAGGACATAAGCCACTTGGCGAATCCC
        ATGCGTCGCAGTAGCATTTCTGGGAAATCCTTCTTGGAACACAAGACGAGGTCAGATACGGGCGGTCAGGCATCATCCAG
        CAGCCTACTGGCCAAAAACCAGCTGCCCCAGGAGCTGCATCAGTATGTGTCAGGGAAGCAGGCCAAGATCAAACAACACC
        ACACAGCCACAATAGCTTCCGGTAGCACCGCCATCAGCATAAACTACGAATGTGATTCGAGCAGCACCGACAACGAGGTC
        CAGGAACCAATCCAAACCAAAGGTGGTATGAACCGCAGGGTGCGCAGCCTAGAGCGCAATCTGGCCGCCACAGGCTCCGA
        AAGGGCCGAAAAGAAGGGAACTCAGAAGCGCACCTCGAAACAAAAGCGGAATCTTAGCTTAGACAACAATCGCCATCAGC
        CCGCAGGACATCCGAAGCGGGAGGCGGTAGCTGTAGCTAAGGTCGGTCACGATGCTGACACACGAGCCCGCAAAGAGCGA
        AATCGGAAGCCCTACGGCGAGATGGGTCCGGATGGTGGTGTCCCGACCGAGGTCAGTGAGTTAGATGACGGGTACTCTGC
        TCGCGGTTCCGCTCAGAGTTCCGCCTGCACCTTACCAGCAGAATCAGCCGCCGACGCGGCGAAAGTTGCTATCGGCAAAC
        GGTTCCTGCGCGGCGAGATTGGAATTAAAAGCTTTAACTACTATCTGCTAAAGGAGGGCTTAAAGAGCTCGAAAAAACTA
        GTGGACCAACAGCGAACCCCAGCTGGCAGTGGCAGTGTGGAGTCACCTCTGAAGGCCGAAAAACGACATTGCCGCAGCGA
        GGAAAACATCTACGAGGAGATCTTCTTTAAGGACACGGCCAACGCGGTGAGCTCGTCGGCAACAGGAGTAGCCACCGGCA
        TGGCGATGCCCGTTGCCCTGACAATGTGTGATCAAGAGACGCACAGCCTGGAAAAAGGAGCTCAGCCGCATGGAATAGGC
        GCCACCAATCCCGCATTTGCAGACTGCGAGTTTTGTATGGAGCAATGCAGCAAGGAAAACTGTGAATATTGCTTGGCCCA
        CGTTGAACAAGTAGCAAGTAAAAAACTGAAGGCGGGGCAAACACAGGAAGAGCAGTACCTCAACCAAGGACATAGGAAAA
        ACCACACTATGGATTCGCGGCCTAGTGCTCCGGTGGTCGAGGTGCCGACCGCCCATATACTAGAGTTCCAGTCGTACAAC
        CCAAATAATCCAGGCGTTTACAAAATTGAGACGACTCCAGTGGCCATAACAGGAGACTACAACCCGATTCTACAATTTCA
        GCAGTCTTCTGCTACTACATCGACCTCAGCTACCACCACGCCAAGTGAACCCCAGATTTATGGTGGATACTACCTGCCCC
        ATGCGAACCAGAGGCCATACCACTCGCCAACTGTTAACAGCCAGCTGCCAAATCACTACGCCGTGGGTGGCAGTCTGCTC
        TTGGCCCAGGTTACGGGGGCCACTCAAGGGTCCGCCACGCCGCCTCGGCGACCCCAGCAGCACTTTATAGTGGGATATCA
        GAACGGAGGAGGTATGTCCGCAGGTGCGGCTTCCTTACAGCGCTTTAACACGAAGTCCTCGTCCTCGAGCGACTCGCTTC
        CCTATCACAAATATAATACCATGGCGCGACTGGAGGCAAATGTGCTAGCAGCTCCTGCCACTGGGGATCTTTACTATGCG
        GTCAGTGGGACGCAGCCACTGCATCCGCTTATGTATGCTGCCAATAGACCCATTGGAGGATCCCAGATACTGGTGGATCC
        CTACGATCCGCAGATGTACAAGAGCGACTCAAAGGCATCAATTCTGAGCGAGTTCTCCCTTCGCAGCAGCGACAACTCGC
        AACGCTACGCTCGGCATCCTCATCGGCGACATGGCGGGCGCGTCAGTGATTCCAGTCTGTTTTCAGTGTACTCAAACTCT
        GGCCAAAGGCGGTACTTTGGAAGCTCGGAAGGCAGGTTCGGATACGATTGTAGACGCTGCAGTCTGGATGGCGTCATTGG
        AATGAGTACTGCGACTGGAGGGTCTATGATGGCTCCCGATAAGTGCAGCTACTCGGACAACTGCCGGTTCGAGTGCCGAA
        ACTGCGACTGCTCGTCAAATTACTTTAGCTCAGACTTTGATGATGTTTACGGATCAATAGCGCGAGGAGGAAGCAGCGGA
        ATCCCGCGAAAAACTGCAGCAGGGACACTGCCATCAAGCGCACAAGACGATCAAGTTGAGCGATTGGAAGCCCCACCAGC
        GTCGATGGAGCAGCAGCAGTACGCAGACCTAAAACAGAACAAGTACGCCCAAGATTTCTTTAAGCATGTTAACGACGTAA
        AACGTAGCATTTACCAGTCGGAAATGAAGAGAAACAATAGCTTGGAGTCCTCAAGGAGTGGTCCAAGAGCTGGCGGCAGC
        ACAAAAAGCAATGTCAAAGCAAGTCCCAAGCGGGCCGCCTCACAGGAAACTAGATTAGTAACTACTCTTCCGCTAAGCAG
        GAGTCGGCTTTCTGCCGGCGTAAAGCCGACACCTGCACCAAGGACCAGTCTCCAGACACCGACTCCTTTGCCGGAGACTA
        CCGTCGCAAATCCCACGCCTAGTAAGCGAAAAAGTCAACCAACTGTCCGGAGAGAGTATCCTTCCTTGGACAGGCTCGTT
        GCGTCTACCACGGGCACCATTCCGAAGAAGAACAGCAGGAACATAACAGCGGCCAGCTTACAAAGCCCGAAGCTGACGCA
        AAAAACTAGATCAGAGGCTCCCGAAAAGAAGGTTGCACCTGAAGATCAGTTGCCGCTGCCTCCGTCCGGCAAACGACACC
        ATCGCACAGGCGCATCGAAGACAAATACAAACGCTCCCTGTTCCAGCCTACGCAGGAAAGACATTCCGGCTCCACCTCCG
        CCTTCCCCCGCTACATATTCCGACCTCCAGGAGCTAAAGGCCAATATGGAGGGTTTTCGAGACGATACTAAGTCACGAAG
        CTTGGAGTACGACACTAACGATCTTACGGCTGACGATAATTCCAATAAAACTCAGAAAAAAAGTCTCAGCGGACCACCGA
        ATCCAATGACGGAAGCCCCAATTGGAGCCACTGATGCAGGTGCAGTGGAGACTGACGACAACGACGTCTTCTATGATGCA
        CGCAGCGAGGATTCTGGCGGTGGTATCTTGCCCTCGAATACCAGTGATATATCGAAAATGAGTCCATCCCACATGGCGAC
        ATTCACACGGGCGGCAACTAACGAAAATCGCAAAGGCGCCTTTGACAACGAAAAGGAGCACTCTGCCGAGGATGATGATT
        CTCCGTCTCCCGCCGCCCCTGCGCCAGAGGGGCGTGAGCAGGCGTCCTCCATCACGGGCAGACCGAAAGGGAATGGCAAC
        AGTAAAATAACCACAACCCCAAGCTGTGAGCTCGGGAGCTCGGCCGAAGCGGAAAGCAAGCTGGACTCCGCCGCACTCTG
        TCGACCCCGACCACGACCTCGCCAAGCGTCTCCCCACCTCCCGCCCGAATGCACGGACACTGGGGGGGCTGGTGACGAAC
        AGGCAAGCAAAACAAAACACGAAAAGAAGACTCCAGCAGACGCCCCCAGGCAACATGTTGGACCAACATGTTCGGAGGGG
        CAGCGAACCGCCGCGCTAGCAACAAATGTTGCTTGCGCACTCTCAACAACCACCAACGCTGGCAACACGAGCGCCAGCAA
        CAGCGTATTGGAGCTGGAGCTCAGTTGCAAGACGGGCAACACGGACAGCGAAACGCCAGCGGTAGCGCACAGTGACCCGA
        CATCCGATGTGCCTGCCTGTGGGACAGCGGAGAATCCAACGCACCTAAGAGCACTGACACGCCAGGACTACGCCTGCATC
        GACTCGAGCGAGGCTCAATCGGACGACAGTCACCTGACACGCGACTCTATCACCCGGGAGTCCCAAAATGACGAGCTCTC
        CTCGTCGACTCTTGAGAAACTAGACGTTAGCACACTGCCACTGCCCGCACTCCCCAAACGTCGCAGAACCCGCTCCCGCA
        CCAGCCCCTCCAAGCACAGGCAACAACAGCAACAGCAGCAGCAACAGCAGCAGCAGCGTCATGAAGTTATCGAAGATGCC
        AATGCGGTTGATGCATCGACCGCAGCAGCAGGACAACAGCACCCCAAGCCACGTCAGGGAGCAGCCTCTCCAGAGTCCCA
        AAAGCCAGAAATAAGCGGTGCAAAGAACAACGCAGCCGGCGAGCAGCAAAAGCAGCCACAGTCGCAACAGCAGCAGACAC
        ACCTCTCCGCCTTCCAGCAGTACGTCGCCAAGCGAAGGGAGAGTCTGGAGGCGTCCAATCGTTGTTTCAACGAGAAGCTA
        GAGGCGCGCAGAATGCATTACCACATGGGTGGGAGCGCAGCAAATGGTAACGCAACCGCCTCCCATCTGACGGCTGGCTC
        CAATGGAGTGCCCACTTATCTTTTCGGTGAAAATTTCTATGGAGTGCCCGCAACTGGACGTAAGTCCATATCTCCCACCA
        CCAAGAAGGAGGAAATATTCCTGAACAAGTCCGGATGGGTGCAGGTCAACACGACGCGTGGGGTCAACAAGGATGACAAT
        GGCGGGGGCTACCGAAGCCTCAGCTACGCCCAACAAAATGGTGGCGGACGTGTTGCGGCGATGCTGACGGATCCTGGGAG
        ACGCTCAGACCTGGCACGAAAGTCATTCATCCTGCAGCATCAGCAACAGCATCAATCCAATATCAGCATGACTGAGCCGA
        AGTTTGTTGGCTCCAAAGTGGAAGAGCTGATTCAAAGGAACGAAGCACGGCTAAGCGGCTGTTCCATACGGTACCCTTCC
        CTGCGTCCGGGCCATCGGATTATCGATCCGCAGCTGGCTAACATCCTTAACGAACGGCCAGGCTTCTTGCCAGTGAAGGG
        CCCGACTGATCTCGACTCCCCCCTCACTCCCATTCTCTCCCCACCTCCCGCTTTCCAGGACAACAGCCGAAGTGCTCGGC
        GTCAGGAGAGGCGCAACCCCGGACGCCAGCAGGGTCCTCTGCCCCTGCCCGTGCCGTTTCGGTCGGAGCCCCAGATGGAC
        CCTCAAAACCCCATTAATGGCTCCGCCAAAGGCATGGTTTTTTCCCGTAGTTTCGAGTACGACACACGTCGTCACACGCC
        CACCGACAACTACGTAGAGACGTTTTCCCGCAGCTTTGATGGAAACTTGTCGGATCGCCTGCTCAACCTGGCCGTTCTGG
        CCGGCCAGCGGGAACGGTCGCCCAACTTCAGCACCCTGACCGGTAACTCTCCGAACTACCTTACGAAACGGGAGAGCGGC
        GGTGGAAGCAGTGGCTCTCTTCGCAGCCGCGACAGCTCGCCCAAGTATCTGCATCCGCAGGCCACAACTGCTTACTTAAA
        TGCCGCTGTCAAAGAGGCGCCTCCTGTCTACAGTGTCCCCACTGGCAGTCAGGCCAAGTATTCGCCGCGTTCCCGTTTCG
        AAAGGACTACTGAGCGTTCCAAAACCCACGCCCTGGGACGTTCCCGTAAGTCCCAGTTCAGCCGCGTGGGCAGTGCCGGA
        CCTCTGATAGCGCATCCAAACACTGCAAATGTGGGAGTGTCTCGTTTCCGAAGCTTTGACACGTCCAAGAGCCAGCGTCT
        TAATTCGTGCGACAGTGGTGCGAGATCAGATCTCTCCAACGATGAGCTGGACAATGAAGATGGCGGGTTGAACGACTTTC
        TATCCGCCGGCAGCCACAAGTTTCCTAAAATTGGAACGAGTAGCGTCAGCGTATCGCCATTCAAAATGCAACGCCAGAGA
        TCCCTGACACCAGATCGGAATGACTCCCATAGCTCGACTAGCAGCTTACGGAAGCAAAGATCAAACACCCCTGAGTCCAG
        ATCCTTGACTCCTGAGGAACGGCGCAAGAAGGGGTCCCAGCTTTCATTGGGCGGTGCCCGGCAAAGCTCCAGCTCGAGGA
        GCAACACGTTTGAGGGCCGCCAGCGGCACGATGACAAAACCCCACCCAACATATCACGCAGCTCCTCCAGCTCCAGCTAC
        AGTGGCGGCGAGTCCCACGAGCCCCTTAATGGCACCGGCAGCACGACTGTTACACCCTCGGCCGGAAGTGGCTCCACCAG
        CCATCGACGCGCATTGACCGCGAAACAAGCGGAGCAGGAGCACCGCATTCGACGCTCGAGATCGTTGCAACTAACCGAAC
        GCTCTCCGAACCGAGCGCACAAATCCATTGTTAACGTGGGTGCCCTGGTCCCGCAGCAGCGGTCGGTAGGTGTTCCCTAT
        CAGCAGTCCCGTGTACCAGGTGGGGGCGTTTTCCCCCCCACTATCCGAACCTCGCCAGCGGGGGCAAAGATCCATGTCAA
        TTCGCCTGCTCCACCCAACAGCTCGGTGAGAGTGCGACACAACGAGACGGACAAGGCGCGCTCCTTCGACTTTGACTACA
        ACAACTTTAGTCGTGGTGGAGGAGCAAAGGGTTCAAGTCGCACCGCACACACTAGTGGCAGCGGAGGAGATAGCGGAAGC
        AATCAGAATCTGCGCGTGGAGAGGGAGTCCCGCTCCTTCGACGACGAAATTTGTGAAGCGGTGCTCAACAACAACAACGG
        CAGCAACGGAAGTGTAAGTGGCCTGCGCTTCCTACAGCCTGCAACCGATTCCGGGCAGGTGTCGATGGCATCCACGTCGT
        CTTCCCGCCTGCGCAAGTCCAACTCGCCTGTCAGCGCGTCTGGAATGGAGGCGTCGCGGTCGCCACAGTCATCGGGATCC
        TCAACCAACAATCTCCATCAGCAGGCGAGGCAATCGGGCAGTCCACAGAGCTACGGGACGCGACTTTGCGACCACGAGCT
        GACTTACGAAATGCTACGAAAGTCGCCGATCATGAACTTCCGGCGTGGGGACAGCGGCGACTACGAACTGCCAGTGATGC
        TACGGAATCGGGAAACCATCAATTCGGGGGGCAACAGTGAGCTCAACTTTATGAGCAACGAGACGCGAATCTACGAGCAT
        CCTACAACCGTTCTAAAGTCACAGCGATCCCTCCGCCAAAGTCCGGGGTCTCGGGACGACCTAAATCTTGAGGTTGCAGT
        GGGAGTGGGAGGCGACTACATCTACAGGCAGCCGGCCAACCAGCCGCGTAGCAGCAGTGTTAAAGCGGAGTTCCTCACAA
        CGGCAACGACGAAAAGTTGCACCAAAACTTTGGACACATGCGATTATTGGCCACGCTGCGCCGCCTGTCAGCATAAAAGT
        GTCTCGGGAGAACTCAAAAAAGGACCGTCTGCCTCCGGAAAACCATTAACCGTTCTGGATAACGTGCAGCCCCATGTCAC
        CTCAGTGATCGTTAATGAAGACAACGCAGTCCCGGGCCCACAGCTCCGAAGCCTGGAAAAATCCAATCCGTCATGGACCT
        TCCTTTGTAGCGGAATTGCCAGCATTTGCCAACCTGTGCAGCAGACGGAAACCGACCATAGCACTGCCCAGGAGGCGGCG
        GAGGAGGATATTGTCATCAGGAAGGTAAAACCCAACAAAAGCCGCAGGACGGGACGTAGTCGTTCTCTGCCAAGTGTAAT
        GCTGCGAAGACTTTATCTTGCTGGAATGCCAAAACCTGGAAGCAATGAAATGGGAACAACCAGTGACTGCGCTGCGAGTT
        TGTCACAGCAAATAAAGGCGGTCTCCAGTCCAACGCTGTCCGAGCCGTGCTTAGAGGAGCAGCCACAAAAAGGAACTGAA
        AGTACGGATGTGGCCAACACAGGCAGCAGCGCCGGAAGTGGAGGCCTAGGCGTATTGCAGAAATTCAAACGCACCTTGAA
        CAACTTTAACAACAAAAATCAATTGCACATCTCTCCGCTATCACCAGCGGCAGTAGGTAACAATGCCCCAAAAACTAAGA
        CATCGCCAACAACAACAACCGCATCCATAGCACCTATGATAACGACGACCACAGCTAGCGATCCTGGCTCAGAGGCCGGC
        GATACGAGCTCAGGAAAATACCGGTTTGGGCCCCTTATTTGGCGTTCTTCCAAAGAACGCCGTAAGACGAAGTACAACCG
        ACGCGACAAGTGTAATTCTGGTGATTCAGGCATACAGATCGAACTAGAACAGGATGAGCAATACTCCCGTGCGACAATGG
        CCGTGAGCCGCCAGGATGAGCCCCGCGCTTTTGCGTTAACCAATGGATCGTGTGGTGTCGCGCTCTCTAAAATGCGAGCC
        ATACGTCGCACCAACTCTGCAAAGGCGAGCAGCATCCTTGGGCCCTTTATTGTTAAAACCAAAATAGCCAAGCACTTAAA
        CATTGGAGAGTCTGACAAAGCCGAGCGCAAAGCGCCCGAGTCTCTACCCACGCGATCGCTTAGCCAACCGAACGGCCTAG
        AGTCCTACGGTATGGGTCGTCCCGATCTTGAGGATAGCGACAGCGATAGTGTCGCGTCAAACGAGGAAGCTATAAGCTTC
        TACCCAACCACCTATGCGGAGGTGCTTTACAACTTCACGGCCGGCGGTCCTCAAGAACTAGGGCTAGAGAGAGGAATGCT
        TATTGAAATACTGCGCAAGGAAGTTGGACCCTGGTGGTTCGGCCGAATTAAGAAGGAGGAAACCAATCTGGTGGAAGACA
        TATTGGGTCCTGAGCTGGGCTGGTTCCCCAAGGAGTTTGTGCGCATTATTCACTGTCCAGAGACGGACAATTTCTTTATA
        GCGCACAGGGCTGCCGCTGATGAGGCGGCGGCTGAGGAAGCCACTGCTCGTGCAGAGGAAGGGTCTGTTCCTGTTCCCGT
        TGCGGCATTTGCCGAGGACACAGACGTTACCGTCACCACAGACCAAAGCAACGTCACCCTTATAGTCATTGAATCACCAC
        CAACTCCGAGTGCACCCAGTGTGGACTTTGTTGCCCAACCGGATCACAGCACGATCATACGCCGCAGTGCCGTTCGCGAA
        CTGCTTGATACGGAGGTCAATTATGTAAAGCTGCTAGCAGCCATTTGTGATGGTTACCTGCCAGCTATGAGCAAGCGAAT
        CGATATATTTTCGCCAAACAGTATTCGGCTTATCTTCTCCAACATAACGGCCATTTATAAGTTTCAGCGAAAGTTTCTTG
        AAGCCTTACGACGAGGCATCGAGCAAAACCAAGTTGCCAAAGTTTTCCTCAAAATGCACAAAGGTTTCCTTTGCTACTCC
        ACCTATTGTAACGCATACCCTCGAGCCCTGATAGAACTTGAGACCTACGATCGCGTAAAAGACGCCCGTACAATTCTTGA
        GAACTGTCGCGAATCCCAAAACCTGGCCGAGCTGCCCCTCTCTGCGCACCTGCTGGCACCTGTGCAACGAATCTGCCGCT
        ATCCCCTGCACCTCAACGAGATTATTAAGTCGGCATTGGAAAAGGGAGCCAAGGAAGGGAACGATACAGACGGTGCGAAG
        TCAGCTGGCAAGACAACTGACTATGAGCAACTCGATGTTACTGAACTAGACATACCCGACTCTCAAGATACTGTCAATTT
        GGCGCTGGAAGCGATGCGCGGCATCACAGAAGCAGTCAATGAGGGCAAGCGCCACAGCGAGACGATTGCAAGGCATCAAG
        CCAGCTTCCAAAACTTTAAGGGCCCGCCGCTGCACTTGCATAGTGCTCGCTTCTTCCTGCAAGTCGATGCCACGCGGCAG
        AAACAGAATCTGTGGAACAGCAGCTATACTCTGTTTCTTTTTGATAACCAGCTCGTTTACTGCAAGCGAGATATTATTAA
        GCGGAGCCACTTCATCTACAAAGGACGCATTTTTCTCGATCGCTGTCGCGTGGTAAACGTGAGGGATGGAAAAATGTTTG
        GGCACACCATTAAGAACTCCCTACGCATATATAGCGAGTCTCGAGACAAATGGTACGATTTTAGTTTCCGTTCGGCGAAC
        CGCAAGCATCGCTTCCTAAGCACTCTCGCCCTGGAGCGCCAGTTTGGTGGTAAAGCTCTATACGTATCAGAGATGACTGG
        ATTCGAGTACAATTACGAGGAGCGGCCGGGCGATTACTCAGACCAATCAGATTACGATGCACAAGATTTTGAATTAGCAA
        CTGGGGTCACCAGTGGTGAGAGCTCACTGCCGGAGTCGCCGGCCAAATCTACGTCTCGCCTGTGTGAGACACTGCCAAAA
        AAATCTCAGTCCAGGGACGGAATATCCAGCGCTGAAAACTCTCAAATAGTCACTACCACATCGACAGGTTCGCTAGGAAG
        GCGGCATTTTGGCAATTGGTTCCGCAAGCCAAAGAGCGCAAACTGCACTCCAAGTCAATCACCGACGCATAAGCCAAGCT
        TCGACGCAGACGCTACGCTCACGGAAGCCCGGGTTGCTGCGATGGAACTGGCTGAAGCCGCGGCCGCACTAGTGCCAACG
        GACAGCTCCTCAGCGTAAATACTAGGGACAGCTTTGTATCGAATCGCAATACAAATACAAACAGCGTAAAGCAAACATAA
        ATTCGTGGTAGAACACACGATATAAAATATTTGTTACATTAATATTAAATTGTCTTAAATTATAGTAACATGTAGTTGAC
        CAGTGTTACACTTCGTAGATGTTTCGTTAGTTACCCTTGGGTTTTTGTTCAATATAAATGATTGTGTTTCTATTTTATCG
        TGTATATTCTTGAATTGGAGTCATTATTTGCAATTAATATTGCGATAATAGGAATATTAGATGTACAATAAAAATACAAA
        TATTGTATACTTCTGGCATTTCAATGCAGTTTTATATAAAAATGTCGCCGACTGCTAGTCTAAAATCCTGTCCATACTTG
        TAATTTTAGGTTACGTGATAATTCGATAATAAATACCCGAAAAGTAATTTAATTTTCTGTTCACGTTCGTATGTTCCAAG
        CAGAAGAGCCGATATTTAAAAGCGTCTGGAAAAGTTTGCTACTTAATTATGTCAAATTTTAACATGATTAACAAAGACTA
        TGTATCTTTGTTTTAATCGTGCATTGAAACAGGATAGTACCCATGTTATTTGTTACTTATTTGTTGGGCTAATCCACTAT
        GATACTGCAACTAAACGACACAAATAAATAAACCTACTAATAAAGAAACTAGGTTATTGCATATAAAACATATTTGTTCT
        ATACAAAAATTGGTTGATTGGTCAATTTGAAATCCTGAGAATTAGCAATTGTTAACTTTACAATACAAGACAAGCAAAAA
        ATGCACCCGAACAATTGAGCGAATTTAATTTTTTCTAAGAGAATCACACAATGTATCTTGGTAGTATTTTAGTATCTGGC
        CAATCTGTTGGCAAGAATTATTTTATTGTCTAAAGAGGTGATTGAAAAATTTAAAAAGCAATTTACTATTTAATAGACTT
        TGCAAAACAAAACGTATTGGAGTTTGCTAAATATTTCTTTTTTAAATATATAGGAAAATATATTAACAAAACAAAATTCT
        ACACAATACACCTGGAATTACAACCAAACTTACCAACCATGTAAATAGCTCAAGAATCTTTATATTTCCAAAAAAGACCA
        AATAGTTGGCTTGGATTTATCGCGTGGTATAACTTGGGCTTATTTACGTTTTGAGAACTTCCAAACCGAAACCAGTTTGT
        TAAGTTTTAAACAGGCAAACTTCATAATAAAACTATATAAAAACATAAAACATTAAAACGTTTCATCAAAACATAGAAAA
        ACAAAGAAAGCAGATGAAAAAATTGTATGTAGTGAATAACTCGTAAGCTTAATCGGACGAGAGAACACATAACGAATCAT
        ATAAACATAGCAACTACAAATATACCCCATATGCCAAATAAATATATATATATTTATCCATGTTAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0333952
        4541
        FBtr0333955
        3086
        FBtr0333954
        3153
        FBtr0333953
        3168
        FBtr0333956
        3564
        FBtr0333957
        3258
        FBtr0333958
        3501
        FBtr0333959
        3082
        FBtr0333960
        3157
        FBtr0333961
        11114
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0306085
        3518
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0306075
        1011
        FBpp0306078
        932
        FBpp0306077
        925
        FBpp0306076
        930
        FBpp0306079
        1011
        FBpp0306080
        920
        FBpp0306081
        1026
        FBpp0306082
        820
        FBpp0306083
        820
        FBpp0306084
        3519
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG43976-RM
        RhoGEF3-RM
        Secondary FlyBase IDs
          References (0)