Open Close
General Information
Symbol
Dmel\RhoGAP68F-RD
Species
D. melanogaster
Annotation Symbol
CG6811-RD
FlyBase ID
FBtr0334092
Feature type
Associated gene
Evidence Rank
Length (nt)
2262
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 25 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GTACTTTCCTAGCTAAATCTGACTCACAAACAGAGTAAAAACTTAACTGAAATGAGAAACGAAAGCGTGATTAAGACAAA
        TTCATCATTCGTATAAAATGTGATGATTTCTTGTGACTTATAGAAATTCGTAACTTAGTATAACAAAAAACCGCATACAT
        TCTACATGCCAATAATCGAGCCCAACGACTGACTGAGCCACGTCCTGCGTCACCGCGAGTAATCCAATCACATCGAACGG
        ATAGCACCTGAATCCGCATCCACTCCCATCTCCACCGCCATGGACGCCCATTCGCGTTTCGCGCCGAGATTACCAGGTCC
        CGCCATCAATCCGATCGTCGATAACTCGGATGAGCCCCAACCCAGTCTCTCCGATCTGCACGACTTCGAGCCGAAGCTAG
        AGTTTGATGATACCGAGCTGCTGGCCCCATCTCCGCTTGAAAAAGATGTTATGGTCGGTGATTTCGTTCTGGCCGAAGAT
        CCAGAACTTGAGCCCGAGGAAGATGTAAATCCGCTGGAGGACGACTTCGAGGACCAACTCAGGGAGCAGTCTGAAAACTT
        TCAGACTCCCAGAAACAAATGCGATTTCCTGGGAACCGATAAGCAGGGTCGCCACATCTTTGGCATTTATGCATCCCGCT
        TTCCCGAAAAATCCCAACTGGAAGGATTTGTGCGGGAAATCATCAAGGAGATCGAACCTTTTGTGGAGAACGACTACATT
        TTGGTTTACTTCCATCAAGGCCTCAAGGAGGACAACAAACCATCCGCACAGTTCCTGTGGAATTCGTACAAGGAGCTCGA
        TCGCAACTTCCGCAAGAATCTGAAGACGTTGTATGTGGTTCATCCGACGTGGTTCATACGGGTCATTTGGAACTTCTTTA
        GCCCGTTCATTAGCGACAAGTTCCGCAAGAAGCTAGTCTACATCTCCAGCTTGGACGAGTTGCGCCAGGCGCTCGGCCTG
        AACAAGCTGAAGTTGCCGGACAACATCTGCGACCTGGACGACAAACTGAACCCCAGCCGGAAGCCATCGACACCGCCGCC
        CAGCAGCAATATAAATGCATCCCGGCAGCAGCAGCACAAAATGGCGACGACGCATCAATTTGGTGTGCCCCTGAAATTCA
        TTGTGATGAACAGTCCGTGCTTAAACTCCATTCCGCCAATTGTGCGCAAGTGCGTGGACTCGCTGTCCATAACGGGCGTG
        ATCGATACGGAGGGCATATTCCGTCGATCGGGCAATCACTCGGAGATCATGGCGCTCAAGGAGCGCGTCAACCGCGGCGA
        GGATGTGGATCTGAAGAGCGTTAATGTCCACGTGATAGCCGGCCTGCTGAAGAGTTTCCTGCGCGATCTCGCCGAGCCGC
        TGCTCACCTTCGAGCTGTACGAGGATGTGACCGGTTTTCTAGACTGGCCCAAGGAAGAGCGTTCGAGGAACGTGACGCAA
        CTGATACGCGAAAAACTGCCAGAGGAGAACTATGAACTGTTCAAGTACATTGTTGAGTTCCTGGTCAGGGTGATGGACTG
        CGAGGATCTGAACAAGATGACCTCCTCCAACCTGGCCATCGTGTTCGGTCCGAATTTCCTGTGGTCGCGCAGCACCAGTA
        CCTCCCTGGAGGAGATCGCTCCCATCAATGCTTTCGTCGACTTTGTGCTGCAGAATCACAAGGACATCTACTTGATCGAC
        GTCAATCAGCGCACAGTGTCCGTGGACTAACAACTGGCCCGGCCACCAACAAGTCCGTAATTGTAAATTGTTTGATTTTA
        ATGTTAGTCCTAAGTGAACCAATGGTTAGCTAAAGAGAGAGCACACAAAAACGCAACAGAAACTAGAGAACAGAAGGCAA
        TGTCGTGTATAAAGTGTACTGTAATCCTAAGTTGAATTTTAAACTGTGTGTATGTGTGTGGAACTGCTTGTAGCCCCAAC
        TCCACGCCAACTGTCCAACCCCCCCGAAAATCACAATTATTTACCCCCAACAAGCGCTTAATACGATTGATTTACCAAAG
        AAATTTGCTCGTGTTCGCTATGCGACGAACAGGAGAGAAATTTGATATGAGATGTTATTATTATATACTACGTATTAATT
        CAACGCACATTCCCCCATAACCGAAAACGAATCTTGGTTGCGTTGCTGAAGGCACATGCCGAGCACAAGTGGAGTTGTGG
        CGAACTCAAAAATCGTACTGTGTAGTCTTGAATTTCCTTATAGTCATACAAACAATTTTTATAAAATAACGGTATTGTTA
        AAAATAAAGCAAGTGTTAAAAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0075997
        2196
        FBtr0334091
        2228
        FBtr0334093
        2193
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0306217
        476
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0075729
        476
        FBpp0306216
        419
        FBpp0306218
        475
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        RhoGAP68F-RD
        Secondary FlyBase IDs
          References (0)