Open Close
General Information
Symbol
Dmel\rols-RI
Species
D. melanogaster
Annotation Symbol
CG32096-RI
FlyBase ID
FBtr0334110
Feature type
Associated gene
Evidence Rank
Length (nt)
5969
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 12 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCGGTACGGATACGGATTCGGTTACGGCGGACACAAGATACGGATACAGCAGCGCCAATCGGATTAATTGCCACATTGGA
          TTATCAGTGATAAAGTGAATGTGAAAGAATATTGACAAAAGTGGCACTACCATTGAAAAACCTAAATCGTGATTGCATAA
          AGTTCCTAAAATATATATTGTTAAACATCCACTGTGCGGATAGATCTTAAAAACGGAAGGGAAAACTGAAATTCCAGGAT
          TGTTCCAACTAGAACTTATCATCTTGTACAAGCAGAGGAATTATAAAAGATATTAAAGTATGCCCTCGCTGCAGCAAATT
          GCGCTCGCGATGGAAGGTGACCAATCGGAGCTACAGACACCGCCGCTGCCGATCAACCCGCCGCCCAAGGTGATGGCCAA
          TGGAATCGTCTATGGCTTTCGCACCCGACACTTGTCCTGCATCGAGGAGAACGACTCGGACTCGTTGCACGGATCGTCCA
          TTCCACATGCCTACGATATGATGCAGCAGGCGGACGAGACCTTCCAGAAGTTGAATGCCAACGAGGAGCAGGACGAGTCG
          GGTAGCGAGGATGGGGGATTGGAGAATCTGGACGATACGATCGCAATGATCGATGAATCGCGCCTTTTGGAGGCCGATTA
          TCTGGATGAGCTCGTGGCCGAGGAGCAGTTGCAGGAGCAGGACGAGGATGAGGAGGAATCCTCTGATCTTGTCGACTCTG
          GCAATGTGGAGGAGGATTTCTGGCAGCCGAGCTTCAATCGGAATGACATCATGATGACCTCGGTTTATGGAGCTCTGAAT
          GGCTCGTTGACGAGCGAAGTGTCTTCAACTGCAGCGCCGGGCTACTCCGAGTGTGCCACGCCCAGAAAGGAGGCGGAACC
          CGTTTATGCCACGCCGGAAAAGCGACGAGCCAGCAATCGGAGTTTCGACTCCACCTGCGCCTCGCTCACCAGTTCCTTAT
          ACGGCGGATCTATGAACTCCTCGCTGGATCTCAAGTACTCATCCTTGGGTGGTGGCGACTCGGTCAGTGGTGGCATTAGT
          GGAACCAGCACTTTGCGAGGAACTTCAGTGCCGCCAATGGATCTGTCCATGATATCCAGCGATGGCGTTAGTGCGCTGGA
          CTGGGGATCTGCCAGTGTGAGCTGTGTTTTGGACTCCGGCGATGGGAATCCCGCCGAGGAGCTCAACGAGGAAATGGCCG
          CCAAGTGCTTGAGTGCAGCGGAAAGTGATCTCCAGTCCATCCGACGACTCCTGGAGCACGATGCCAGTGGATCCGTTTGC
          CCCTCCTGCCGCATATCCTTCGACAAGGGCAAGAGACGGAAACTGATCGACACCTGCGGCCACGAGCGGTGCTATTCCTG
          CATGTTCCGCAACGACCAGTGCCCCATGTGCATGAACAGCTCGCTGAAAGATGTTGATGGCGCCAATGCTCAGGGCTATG
          ACACCGGAATCGGTGGCTCCACATCGACGATAGTGAGTCCTCTTGGATCCCCGCAGCCGCAGCTCAGATCGCATGCGCAA
          CGAAACGCAGCGCTGGCGCGCTACATGCAGCACCGCCAGGAGTCGCAGTCGCCAGATTACCACCATCGCTATGCGAGCAA
          TGGCAAACTGCCCCGGGCGGCGGCACTGTCTACCAATGGCAATGGATTTACCACCGGCACCACGCAAACGGTCACAGTGG
          ATGTGCATCACCAGCTCGGCGGAGGAGGAGGAGGTGCTGCCGCCGCGGCCAAGCAGTTGATGGCCAACGGCATCAGTGGC
          CATAGTCGCAGCAGCAGCATGAGCCACAACATCCATGCGGCAGCCTACAGCGAACTGAGTGCCGCACCACCGGCCTTCGC
          CACACCGCCGACGCGTAGGCGGTTCTTTAACCACAAGAATCTGCGCAGTGCCCTCACTGGAGGAAGTGGCGGTGGATCGG
          GAGTCGGCGGTGGTGTAGGAGGAGCTGGCGGTGTGGGCGGCGGTCATCGACGCACTGCCTCCAATGGGGGTTGTCCCATT
          GACACAGCATCGATCCTGTCGGGAGGAAGCGACGCTATTGACCACCACTCCTCCTTCCTGAATGAGAAACTGCAGAAGGA
          TCAGCTCCACGCCCGTCTCGGTCTGCTGCTCAACGATCCCGGCAGCAATGGAAACAGCAGCAGCAGCGGAAGTGGTTGTG
          AACCCATCTCGGCCCATTCCACCACCAGCACCACGAGCAGCAGCGGCGTGGGAGCGGCCAGCACCACCACGAGCGGTTCC
          TCGCAGAATGTCAGTCCGGAGCAAACGCTGGCCAGCGGAGCCGGAATGCTCAGTGGCAGTCAGCTGTCGGTGGCCACCAG
          TCATGGGGTCAAGGAGGATGCACTGAGTCTGTGCGGCAAGTTCAAGGCTGGCTGCTCCATGCTGCACGTCTACGAAGCAT
          TGCCCAGCAAGAGTCGCAAAGGAAATGTACGGAGATCGACGCGTGGTCAGCAGGGATCCAGTTCGAGCGCATCGGCGGCA
          TCAGCAGTGGGATCCAGGGTGACAGCCTCCAGTTTGGCGGCTGTGCAGTTGGCCCTGAAGCCACTGTTCTTTGAGGTGCC
          GCTGCAGGAACCGGATCCACCATATGTGGGTCGCCAGTGGCTGGTGCAGCAGTTGTCCAACATCCTGCTTGGCACCGAGA
          CACGGGTGGTGCTCATTAACGGACAGCCGGGCACTGGAAAGACGGCGTTTTGTCTGCAGCTGGTGGAGTACTCCTGCTTT
          GGCCGCCGGCAGATGCAGGATGATCCCGATGGCATATACAGTCAGCTACAGTTGGGCGCCCACTGTGAGCGCATGCGCGG
          ACTGGCCTCCCACATGGTTGGCTATCACTTCTGCCAGGCGGACGCCAATCTCACCTGCCAGGTGCCCGATTTCGTGCATT
          CTCTGGCCGCCCAACTGTGTCAGGCGCCGCAGTTAACCGCCTACAGGGATTACCTGCTCTCGGAGCCGCATCTTCAGGAC
          ATTCTCAGTGTGCGAGAGTGCATCGCGGATGCGGAGAGAGTAATGAAGCTGGCTATACTGGAACCACTGGCTCACCTTCA
          CCGGGCGGGAAAGATACCCGCCAAAGTGGCCGTCATCGTGGTGGATGCCTTGTGCGAAGCGGAGTACCATCGTCCCGATC
          ATGGTCACACCATTGCTAGTTTCTTGGCACAGCTTACGCCACATTTTCCAGCTTGGCTCAAGCTGGTGGCCACTGTGAGG
          ACCCAGATGTTGGAGCTGGTGAAGGCACCCAGCTACACACAACTTACCCTGGACAGTTGGGCCAGCAGCCAGGCGTTGCA
          GCAGGATATGCTTGATTACATAGGCGCTCGGCTTGCAGATAGTCCGGAAATTCGAATGAACATCGGCGGCGGAGGAGGCC
          AGAACTCGCAGTCGGGCAGCCAGCCGCAGACGAAGTTCGTGTCCCATCTTCAGTCCCTGAGCAGGGGCTCCATGCTGTAC
          GCTAAGCTCATCCTGGATCTCATTGCACGCGGCCAGTTGGTTATCAAGTCATCCAGCTACAAGGTGCTGCCGGTCTCTCT
          TGCTCAGATCTTTCTGCTGCACTTCAACCTGCGCTTTCCCACCGCCCGTAGCTTTGAGCAGGCTGCTCCGATCCTCAATA
          TATGCCTGGCTGCTCTGTATCCTCTGACGCTGGACGAGATCTACTACAGTATGGAGGCACTGAGTCACGGACGGGAGGCA
          CTAAGCTGGCCGGACTTCATGCAACGCTTTAAGCTGCTGGATGGATTTTTAATCAAGAGGTTGGACAACACGTACATGTT
          CTTTCATAGCTCCTTGAGGGAGTGGCTCATGCGAAGGGATGAGGGGGAGTCCAACAAGTTCCTCTGCGACGCCCGTTTGG
          GTCATGCTGGAATCGCTTTCCGATTATCCCGACTGCAGGCTCCATTGTCACCTCAGCTCACATTGGAACTGGGTCACCAC
          ATGCTGAAAGCACATTTATACGGAGGAACTAGTCTGACGCTGCTTTCTCCGCGGGATTTGCAATCTTATTGGTTGGCGGG
          AGCGGCGGATAACATTTCATCCTCGCTGGGCGCCCTGCGAAATGTCTACAGTCCGAACCTAAAGGTTTCCCGACTAGTTC
          TCTTGGCAGGAGCTTCACCGAATCACCGCACGGATTACATGGGTGGAGCTCCGATCCTTTGCATAGCTGCGCATGAGGGA
          ATCCTTCCCATGGTTAGCCTGCTCCTAGAATTCGGTGCCGATGTCGGTCTGACCAACAGCCAGGGCTGTACTCCATTAAT
          ACTGGCCGCCATGCGTGGCCACTGCGACGTAGTGCGTCCATTGGTAGCCGCCGGCAGCAGCCTCGGTCAGTTGGACATCA
          CGCAGCGCTGTGCCCTAGTTCATGCCGCCCGCATGGGTCACCTCAGTGTGGTCAAGTACTTGCTCGCCTGCGACTGGTCA
          CCACGACCGCACTCCCAAGATGTCACCAGATCGGTTGCCTTGCAACAGGCGCTCATTGGAGCTGCCGCACAGGCGCACTG
          CAAGATCCTTGAGGATCTTCTGGATCTCAATGAGACCGAGTTTGACCTGGACGTGAATGGCATGGAGCCAAGCAGTGGTG
          AACTGGCGCTAACCGCCGCCGCACGGCACGGATGCATTGATGTTGTAGGAATCTTGCTCTCCCGTGGCGCTCAGATCGAT
          GCAAGAAATCGGCAGGGATACTCGGCGCTTTGGTTGGCTGTCAAGGAGGGTCACTGGAGTGTGGTGGAGCATCTGCTGCA
          ACGTGGTGCCCTGTTGGATGAACCATTGGGACAGACACGCAAGACGCCGCTAATGATTGCGGCGGAGGAGGGACACCTGG
          AGCTGGTCGATCTGCTGCTGGCGCGGGGAGCGCAACGAGAAGCTCAGGATCACGAGGGATTCACTGCACTCAGCTGGGCC
          TGTTTACGTGGCCACTTGGCGGCGGCCAAGACGCTCATAGAACATGGCTGTAATCGCCACCACGAGGATCACAATGGACG
          CACAGCCCTGGATCTGGCAGCCTATCAGGGAGCCGCTAGCCTGGTGATCTATATCCTGGAGCAGGGCGGCAATCTGGAAC
          ACATTGATGTTCATGGAATGCGTCCCCTGGATCGGGCCATTGCCTGCCGTAACATCCAGGCCGTACAGGTGTTCCTGCGC
          AAGGGGGCCAAACTGGGACCGACCACTTGGAGCATGGCCATGGGCAAGCCGGAGATTCTGGTCATACTACTGAACAAGCT
          GCTCGAGGACGGTAATGTGCTGTACCGGAAAAACCGCTTCCAGGAGGCTGCTCATCGCTATCAGTATGCCCTACGCAAGA
          TCTCCGGACTGGAGCAGTTGCTCGAAAGGAATGCCATCTTCGCCCAGCTGCGGACCAATCTTCTGCTGAATCTGTCGCGC
          TGCAAGCGAAAACTGAATGAACTTGACGCCTCCATAGATTTGGCCACGCAAGCGATTGCCCAGAAGCCGCACAGCTACGA
          AGGATACTACGCCAGGGCAAAGGCGCGCATGGAACTTGGTGCATTGAATGAAGCACTTGTGGACGCCAATGAGGCGATGC
          AGCAGGCCGCCCAAAGCGGTGTGCTCTGCGAAGTGGTCGAGGTGCTGAAGCGCATCCAGACCGAGCTGCTCACGCGGATC
          AGCATCAGCAGCGAGGATCAGACCGGCAGGATGTCGAATATCGGCGGCGGGGCATCCGTCGCATACGAATCTCATCATGA
          GATCACCGATTTGTAAATGTCGATTGTTGTGTATTGTTGTACTCGTCGTATACCCTTCGAATTAATCGCTATTCCTACTT
          AAGAGCTACCCTAGACCTTAATTTTTGCTATTTATTGCCTTCGAATGTTTTTAATTTAAACCAACTGAAACTATCATTGT
          AATTTGTTTTTAAATTTTCTTTTTAATTGTGTCTGCGCATGTAAAAATTAGTTTTATACTCTGATTTAGCATAGGCATCA
          GTTCTTATCCATAACGAATATTAAATAAATGCGAATTCTTTTAAGATTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0076056
          5505
          FBtr0076053
          6275
          FBtr0076057
          5832
          FBtr0076054
          6026
          FBtr0076055
          5849
          FBtr0310009
          5846
          FBtr0310010
          5972
          FBtr0334109
          5502
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0306230
          1798
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0075788
          1569
          FBpp0075785
          1900
          FBpp0075789
          1670
          FBpp0075786
          1569
          FBpp0075787
          1670
          FBpp0301715
          1669
          FBpp0301716
          1799
          FBpp0306229
          1568
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          rols-RI
          Secondary FlyBase IDs
            References (0)