Open Close
General Information
Symbol
Dmel\CG3262-RF
Species
D. melanogaster
Annotation Symbol
CG3262-RF
FlyBase ID
FBtr0334169
Feature type
Associated gene
Evidence Rank
Length (nt)
900
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 33 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTATCGTTTTGTAACAATGGAGCGTCTATTGATCAACACGATATGGCGCTCCTACGCAACAAAATTAACTGGGTCCCAGG
      TGAAGTTAATGGCGCGGGGATTGCCTAAAAAGCAACCGATTATTGGAGTACAAGATATTATAGTCGTTGCCTCTGGAAAG
      GGTGGTGTTGGAAAAAGCACCGTGGCAGCTTGGCAAAACTAGGAAAGCGAGTAGGATTGCTGGACGGGGATATCTTCGGG
      CCTACTATTCCACTTCTCATGAATGTCCATGGTGAGCCGGTTGTGAACGATAAGAATTTGATGATCCCGCCGCAAAACTA
      CAATGTAAAGTGCTTGTCTATGGGCATGCTGACACCTGTAGAGACCTCTGTTATCTGGCGAGGTCCTCTTGTAATGTCAG
      CAATACAACGACTGCTAAAAGGTACTGATTGGGGGCTTCTAGATGTCCTAGTTATAGATACTCCACCGGGCACTGGAGAT
      GTACATCTCTCACTATCCCAGCATGCACCTATCACAGGGGTTATCCTGGTAACAACACCTCATACTGCAGCTGTTCAGGT
      GACCTTGAAAGGTGCAAGCATGTACGAAAAGTTAAATGTTCCTATCTTTGGCGTAGTAGAGAACATGAAGTACACCATTT
      GTCAGAACTGTAATCAACGATTGGAGTTTTTTAAAGACAGCCGTATAAGTTCTCTACCGCGCAAGCTAATTTCTCTTCCG
      TTAGACTCACGAATAGCGGATAGCAACGAGAGTGGAGTGCCTGTTGTAATAAAATATCCGGACAGCAAGTACTCTTATCT
      ATTTACCCAATTGGCTGAGGAGATTACACAAATACTTAACGAACAAAGATGTAATCAAAATCAAAATAACAGTGCACATT
      AAAAAAAATTTGTGTATATC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0299875
      1013
      FBtr0334168
      7023
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0306286
      207
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0289153
      293
      FBpp0306285
      293
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      CG3262-RF
      Secondary FlyBase IDs
        References (0)