Open Close
General Information
Symbol
Dmel\Hn-RD
Species
D. melanogaster
Annotation Symbol
CG7399-RD
FlyBase ID
FBtr0334646
Feature type
Associated gene
Evidence Rank
Length (nt)
1821
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 31 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATTCGTTTGCTGAACGGATCGTTCGCCATCGGTTTTATTGTACTTATCAGTGGAGAAACCCGAGAATCTTGTGAAAATGT
      ACCAGCGGCAGGTCTCCTTTGATAAGAGTAAAACCTGAATTAAGACGTCAGGCGCATATATTGGAAGTAGAAACAGTACA
      GCTTAATAAGATGTCATATAAATACATTAAGAACAAATAATTCAGCCCTGTTAGAGGACCTTGTTATGGCTCAAGATCTT
      GCAAAGTATACTACTTGGGAGACCTTCCCACAGATACAGCACACCAAGTTCTAGGCCGAGTCCTTGGCAATATGCGCTGA
      TTGCCATTGCGGTCGGACCTAAACCTTCAATATGGGGGTTCAAGCCAAAACACAAACAATCTCAATGATGCAGATCTGAG
      CCAACGCGCGTAGAGGATTCGGCTTACATAGTCGAGGGTGTAGATATTAAGGAGGCCAGGAACACCTGTCTTCTGTTTTC
      GCCCAAGGATTCGTCGTTGTCCAGCGGAGCTTTGGCCAACATTTTGGCCATCTTCAAGAAGCATGACATAAACCTGGTGC
      ATATTGAGTCGCGTTCCTCGCTGCGTGTTCCCGGTTATGAGTTTTTCGTGGAGGCCGATGGAAAATCGGGAGCCTTGGGA
      AAAGCCATCGAGGATGTGAAGGAGCAGTGTAGCTACTTTAACATCATTTCGCGTGACTACAAGGATAATGCCACGGCTGT
      GCCCTGGTTCCCGCGGCGTATACGCGATCTGGATCGTTTCGCCAATCAGATTCTGAGCTACGGATCGGAGCTGGATGCCG
      ATCATCCTGGTTTTACCGATCCGGAATACCGCAAGCGTCGCAAGTACTTCGCCGACATTGCCTACAACTACAAGCATGGC
      GAGCCCTTGCCCCATGTGGATTACACCAAGGAGGAGATCGAGACCTGGGGCATTATCTTCAGGAATCTTACGAAGCTGTA
      TAAGACACATGCCTGTCGCGAGTACAACCACGTCTTTCCCTTGCTGGTGGACAACTGTGGATTCCGAGAGGATAACATTC
      CCCAGCTGGAGGATGTGTCCAACTTTTTGAGGGATTGCACAGGTTTCACTCTGCGTCCAGTGGCTGGACTACTCAGCTCT
      CGGGATTTCCTGGCTGGACTGGCCTTCCGCGTCTTCCACTCCACTCAGTATATCCGACATCCCAGCAAGCCCATGTACAC
      ACCGGAACCAGATGTCTGCCACGAGCTGATGGGCCACGTGCCGCTTTTTGCAGATCCAGCTTTTGCCCAATTCAGTCAGG
      AGATCGGGCTAGCTTCCCTGGGAGCACCCGATGATTACATTGAGAAATTGTCCACCATCTTCTGGTTCACTGTTGAGTAC
      GGCGTGTGCCGCCAGGAGGGTGAGTTGAAGGCGTACGGAGCTGGTCTGCTGTCCTCCTACGGGGAACTGGAGTATTGCCT
      CACGGACAAGCCGCAGCTGAAGGACTTTGAGCCGGAGGTCACTGGCGTCACCAAGTATCCCATTACTCAGTTCCAGCCTC
      TGTACTATGTGGCCGATAGTTTCGAAACCGCCAAGGAGAAGACCATTAAATTTGCGAACTCGATTCCCCGACCCTTTGGT
      GTTCGCTACAATGCCTATACTCAGAGTGTTGAGGTTCTCGACTCGAAGCCCCAGATTTCGAATCTGATGGACAACATTAA
      CTCCGAGTTCCAGATTCTTCAGAATGCCGTTGCCAAGCTGCGCGTCTGAGTAGAATTCATATACATTTTTTACTCCCTCT
      CTTTACTTACTATTAAGAATGAATCAAATAATAAATAACATGCAATTATGTAAGTTTTTGT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0076811
      1625
      FBtr0100225
      1617
      FBtr0334645
      1527
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0306708
      178
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0076523
      452
      FBpp0099602
      447
      FBpp0306707
      452
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

      5' UTR based on RNA-Seq data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      Hn-RD
      Secondary FlyBase IDs
        References (0)