Open Close
General Information
Symbol
Dmel\CG8176-RF
Species
D. melanogaster
Annotation Symbol
CG8176-RF
FlyBase ID
FBtr0334651
Feature type
Associated gene
Evidence Rank
Length (nt)
4726
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 61 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          ATAGTATAATTTCAGCATCGACTTGTTGGCCAGCTCTAGTTGCGCTTCGCTCAGTGCTAATGAAAAATCGAATTTTTCGC
          TTCAAATCGACTGAAGTTTACACGGGCTAAAGTATTACAGAAGTTTGGCTCAAGCCATTACACAACATGCAATAAGTAAA
          TTATTTACATAGACAACACTAAGCCTAAGCAAGATACTCTCCAGCAACAAATGCCCATGCATGCTGAGGACGGAGCTGAA
          TCTGATGATGAGGAGTCCAGCCCAGGCAGACATTAGCATCGTAAGGATCATACTACTAATTTGGCGCCCATATAGAAGTC
          AAGTCAATTACAACGCCAGAAAGCCTTTTATGTTAATCGAGAGTGGAAAGGGAAAATAATTTTTTTGCTAAACTAGCCTA
          GAGATCGAAATATTAAGAATACAACTAAAATGACGGTGGATTTCAACGATTATTTTTGGGGGGAGAAGAACAATGGCTAC
          GATGTTCTGTACCACAACATGAAGTTCGGCCTGATTGCCAGCAAGGAGTTATCCGAGTTTCTGCGCGAGAAGTCTAACAT
          TGAGGAGCAGAACTCAAAGATGATGTCCAAGCTGGCCCACAAGGCTGGTACACTAAATAGCACATTCGCTCCTGTTTGGA
          CCATACTGCGAACATCGGCAGAGAAGCTCTCCACGCTCCACCTGCAGATGGTGCAAAAGCTGACTGAGCTGGTCAAGGAT
          GTTGCCAAGTATGCCGACGAGCTGCACAAAAAGCACAAATCCGTCAAGGAGGAGGAATCGCAGACTCTTGAGTGTGTCCA
          AGCCATCCAGACGTCGACGGTGGCAGTGCAAAAGTTGCGCGATCTGTACGCCAGCAAGGTCCAGGAGCTGGAGAAGCTGC
          GCAAGGACAACGGCTCGCACAAGGATGCCGAGAAGCTAGAGAGCAAGCTGAAAAAACTGCAGGAGGAGTACAAGGCTTTG
          TTGGACAAGCATAACCCCATTAAGAACGAATTTGAGAGACGCATGACACAGACCTGCAAGCGCTTTCAAGAGATTGAGGA
          GGTGCACCTTCGTCAAATGAAGGAGTTTCTGTCCACGTATCTAGAAATGCTGCAAAACAATCACGATATGGTGGGTCAAG
          TACATTCCGACTTTAAGAGGCAGTTTGTCGACATGTCTGTTGATAAACTCCTGGAACAGTTTGTGCTCAATAAATACACG
          GGATTGGAGAAGCCAGAAATGCCTGAACTGGAGTATGTGGCCTTGTCGAGTGGTTCTCGCCTTCAACAGCCGCAGGTCTC
          GGCCAGCGCATCTAACTCCAATTCGGCCACCAGCATTCAGGCTGCTCTGCGGGCTGGAAATGCAGCAACGACGGCCTCGG
          GCAGTGCGGTGTCCATGGATCAACGGGGCGATGCCTTGGCGGCAATCTCTCTGGGCAGCGGAAGTGCAGCCAGCGGTAGT
          ATACCCTTTGCCGAGGATCCGATACTGGGAGCTATGGGCTCTCCGCGTCCCACATCGCCGGACATGCTGGCGGGAGCCAA
          TGCATCGGGAATACAATCGCAACCGACTGGTGGAGCCACATCCACGGTGAAAAGCCTGCGATCCTGGTTTTTGCCCACTG
          CCAAACAGCAACCGTCTGCAGGCGCCGGAAATTTCGGTATGGCCGGAAGTGGCAGCACCAACAATACCACCACCACGACA
          ACAGCAAGCAACAATAGCAACAACTTGAACACCAACAACACAACAGCAACAACTACAACAACAACTGGCACGAATAATCT
          TACCACAAATATCACCAAAAATTCCCCTAATTCTGAGGATACTAGCAATCAAGATCAGACACAACAGCAACCGGCAGAGG
          CCTTAACTCCAACCGCAAGTGCCACTGCAATTGCAGCGGCGAGTGCGCCTGGGAAGAAGCAATTGAACGCAACGACAAGC
          GAGCAGCAGCTATCGAAGTCATTAAATGAGCAAGAGCACCTACAACAGACTGCAGCAGCTACGGCAGCCACAACTGCAGC
          AGCAACAACCGCCACAACGACAACGTCCAGACGTGCAACGTCACTTTTAAATATATTCACATCAAACTCTCAGGTCTCTG
          GCATTTTACGCAGTCGTCGCGACAAGACAAAAACCAAAAAGGCTAAGAAAAAGAAAGACAATGAGGCCGCCGAGAACATA
          CAGGAAGAACGCCTCACCAGTTTGGATCGAGGCAACAACACGCTGCTGGACTATGACGACCATGGGCGCAGCATGAAGAC
          GCAGAATTCCAGCGGCAGTAGCGCTGGCGGTGGCTTGGCCGCCCTATCGGTGACCTCAGCTCAAGGAAGCGTTGATTCTG
          CAGGAGCAAGTAGCATGGGCGGAAGCGGAGGTGCGGCAGTGGCCAGTGGGAGCCTACCCAATGCAGGCGCCCTGACCAAC
          TCGGCTTCGATCACAGCTCCGGGCGCCGCAAGTGGGACCGGAACTGGATATGAGGTCGATGAGGAGGGATTTAGCATACA
          GCCTGCTAAGGAAATAGCGTGGGAGGAGGGCCAGGATAAATCTGGCAGCTTCTATTCCGACTCGGATACGGATTCGGACA
          ATGACAAACAGGAACGTCGGATCCATGTCAGCATTAAGCCTTTGAAGAATGGTCAAGCGCCCATGTCGGCCAGCGTGGAT
          GAGCTGCGTGCCACCGTGGAGAACATTTCGCTTTCCCCAACTGGAGTTTTTTCACATCACAGCCAGCAGTTGCAAGCAGC
          GAGAGGAGCTCCGGCGTCGCGTCAACAGTCGCCGGAAATATCGAATGCCTCCACTCCCACGGCCAGTGTGCATCCTTATG
          CCCCGCTGCAGAGTCCCACGCTGTCCAACAATAATAACGCAAACAACACGACCAACAGTCGTTATGCCGATCTGGGCGAT
          ATCTTCTCAGAGTTGGGTGACATGAGTATGTCGGCGCCCTCATCGGCGACGCTGGGAAAACCTCCCGGAAGGCAAATACC
          AACACCGACGTCAGCGTCAACAGGTGGAAGCATAGCCATACCACGTCCGCCATCACGACGCTCTGATATGATTGCCATTG
          GACCGGCGGCAACAGGGACAGCGCCAGGTCGCGGCAGAATGTCCCCGGCACCGGTGACGGCCATGAATCGAGCCGAGAGC
          ATTGGCAGTCTGGAGTTCCGTACGGCTATCGGGGGAGTGGGATCCTCGCGAGGCCCCTCTCCACTTACAATCGGTATTTC
          GGACACTATACCGCTGGCTGTGGCATTCCACGAAATCATACACGCATATTTTCGGGGCAGCGATGAGTCGCGCTGCCAGG
          TGAAAGTGTCCGGTGATATGATGCTATCATTCCCAGCTGGCATTGCCGGCCTTTTAGCCAATAATCCAAACCCAGCCAAG
          CTGGGTTTTCGCATTAAGCACGTTCAGAATCTGGAAAACCTGGTGCCTAACGGAAAACTGGTGCAAATAGATCGCCAGCA
          GTCGAGTTCTGTGAGCACGATGCTGGAGTTCAATATGGGTGCTTTAACGGCCCTGCTCCGAAGGCAGGCGGAGAATAACC
          CGACTGCCTCCTACTTCAACGTGGACATACTCAAGTATCAGGTGCGCACGAAGCCGGGAGCCAGCTCGTGTCCCTTCCAA
          CTTGTCAGCTACTGGAAGTGTGAGTCCAGCTACACGGCCCTTAAAGTGGACTACAAGTACAATAACCACGCCATGGCCAG
          TGCCTCGCCCCTTCTGAATGTCACGCTCTCGGTGCCCGTCAATGGATCTGTGCGCAATGTCCAGTCAAAGCCGCATTCTG
          CCTGGTTGGGCGAATCGAATCGTTTGGTGTGGAACTTTACGGACATCTCGCAGAATTCACAAGACGGCGGAGTGGGGACG
          CTGCGGGCACGCCTGGAGCTTAACGATGGTCCCTCTACACCAGCACTACTGGCCACTCAGTTCAACTGCGAGGGCACCAC
          ACTTTCGGGCATCGAGTTTGAGCTCCAGGGCAGCGGCTATCGCTTGTCGCTGGTCAAACGGCGCTTCGTTTCTGGAAAAT
          ATGTGTGCGAAGGCGATGGCATTCGCAGTGGAGCCACACCCACGCCTCCGTCGGTCGGGTCCACCAGTCCGTACTCGGCG
          AAGTCAAATTAGTTACTCCCCACTCAATAGACGGCAAATGGGAACGAAAAATGGCAATATGGCAATAGGCTCGTGAAAAA
          CTAGAGAAATTTTTGTAACTAATCTTAAATATGAGACAACCACATATACACCCAAACCATATTGAATTAGGCACACGAAT
          AGAGGAGCCTACATAGTTTTCTCTGAGCTTTTTATTATACCCCCCTTTCTTGATTTCGAAATGGACATCACAATGCGGAA
          TGAAATTGACAAACTTTAAGATTTCCACAGATCGAAGCACGACAAGATTGAGGAAACTGGAAATTCTATCAATTCGCATT
          CCAACAGTTTAGATCCAAACGAAATCGAAAGTGGGACCTATTATGTATTTTTGTACACACAAAATTCTGTTTTTCACGCG
          AAATGTTGAATCTGCCTGCGGGAGGTCCGAAATGCGGGCCTGCAAAATCTGGATGTATTATTTGTTATATATATACGTAT
          GCGAGTATATATTATTAAAGTGTATTTATTATGTTTAACTGAATATGATGTAAACGAACGATATTGTATGTAGCTATGTA
          GATATCTAAAAACAACACACCGAACGTTAATTTTATGTTCACTTTTGTACACACAACCAAATCCAAATGTATTAAATGTA
          AGATAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0082065
          4651
          FBtr0113207
          4955
          FBtr0334650
          4465
          FBtr0334652
          4549
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0306713
          1220
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0081543
          1133
          FBpp0112119
          1220
          FBpp0306712
          1133
          FBpp0306714
          1161
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG8176-RF
          Secondary FlyBase IDs
            References (0)