Open Close
General Information
Symbol
Dmel\Syp-RL
Species
D. melanogaster
Annotation Symbol
CG17838-RL
FlyBase ID
FBtr0334714
Feature type
Associated gene
Evidence Rank
Length (nt)
2837
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACGAAGTGAAGACCAGAATTGCGAGCGGAGCGGCCACAGCCTCTGCTTCTGATTCTGCTGCTGCTGCTGCCGATTCTGAG
        TTCTCGATTCTCAGTTCGATTCTCAGACGTTGGCGAACCGAGAACCGGTGACGTAGACGTTGCCGTCCGCCATTATTACA
        ACGCGGCTGCCACACGCAAAATTGGACATACCAGCTAACCAAAAATAACCAACGCCAACTGCAGCTCGGATGCGAAGTGT
        GCTTGCCAAAAGTCAAACGATAACGAAAATAACGCAGGACCATAAAATTCCCATAGTTATATTAACAAATAAAGCAAAAT
        ATGAAATATGCTGGCTGAGAGCGCGCGCGGCATGCGAATCGAAACGGAAACGTAACGACGGAACGGCGGGCGGCCAATTG
        TGATCTCATATACGCTACGATCTTAAATAAAATACAAATATTCTATTTAGAAAATGCCTGGAATCTAGCAACAAATTGTG
        CAACGCCGAGCAGAGTATAACAACTAAACAAAATAAATACCGATAGTTCAAATTGAACGCAACGAAGTAATATTGTGAAT
        TTCTTAGTGCAAGCCAAATAAAACAAACCACAAAAAAGAAATGGCGGAAGGTAATGGCGAACTGTTGGATGACATTAACC
        AGAAAGCCGATGACCGTGGCGATGGCGAGCGTACAGAGGATTATCCCAAGCTGCTGGAATACGGTCTGGACAAGAAGGTC
        GCCGGCAAACTGGATGAGATCTACAAAACCGGCAAGTTGGCTCACGCCGAGCTGGACGAGCGCGCCCTGGACGCGCTCAA
        GGAGTTTCCCGTCGATGGTGCCTTGAATGTGTTGGGACAGTTCCTGGAATCGAACCTGGAGCACGTGTCAAACAAGTCCG
        CCTACCTATGCGGCGTGATGAAGACGTACCGACAGAAGAGTCGAGCCAGCCAACAGGGCGTGGCCGCGCCCGCAACTGTC
        AAAGGTCCCGACGAGGACAAGATCAAGAAAATCCTCGAGCGCACCGGCTACACATTAGATGTGACGACAGGTCAGCGTAA
        ATACGGCGGACCGCCGCCGCATTGGGAGGGAAATGTGCCAGGCAACGGTTGCGAGGTTTTCTGCGGCAAGATACCCAAGG
        ACATGTACGAGGACGAACTGATTCCGCTATTCGAGAACTGCGGCATAATCTGGGACCTACGACTCATGATGGACCCGATG
        ACGGGCACAAATCGTGGTTATGCATTTGTCACATTCACAAATCGCGAAGCGGCCGTCAATGCAGTGCGACAGCTCGATAA
        TCACGAAATAAAACCCGGCAAGTGTCTAAAAATAAATATAAGCGTACCGAATCTGCGCCTTTTCGTAGGCAATATTCCCA
        AGTCAAAGGGCAAAGATGAAATTTTAGAGGAATTTGGTAAACTTACAGCTGGCCTATACGAGGTAATCATATACAGTTCG
        CCAGATGATAAGAAAAAGAATCGCGGCTTTTGCTTTCTTGAGTACGAGTCACACAAGGCGGCGTCTTTGGCCAAACGAAG
        ACTTGGCACAGGAAGAATTAAGGTTTGGGGATGTGATATAATAGTCGACTGGGCCGATCCACAGGAGGAGCCGGATGAGC
        AAACAATGTCCAAGGTTAAAGTTCTTTATGTGCGAAATCTTACCCAGGACGTCTCAGAGGATAAACTGAAGGAACAATTT
        GAGCAATACGGAAAAGTGGAACGCGTTAAGAAAATTAAAGACTATGCCTTTATACACTTTGAGGATCGTGATAGCGCCGT
        CGAAGCTATGCGTGGCCTTAATGGCAAGGAGATCGGCGCCTCGAATATTGAGGTCTCTCTAGCCAAACCCCCCTCGGACA
        AAAAGAAAAAGGAGGAGATTCTGCGTGCTCGTGAGCGCCGCATGATGCAAATGATGCAAGCGCGTCCCGGGATCGTGGGA
        AACCTGTCGCCGACACATCCTAGCATAATGTCCTTGACGCCCATGCGCCCAGGGGCGCGCATGCCGCTGCGTACGCCGAT
        ACCCCGTGAATACGACTACTTTTACGACTTTTTCGGTTTCTCGGACTATCGCCAAGGGGGGTCCTTTGGCAATAATGTGT
        CCTACTACGATGACATGTACCGCTGGATTGATGGGGATTACAACTACTATGATTACCCGAACGGTGGCGGCGGGGGCAGC
        GGGGGAGGAGGAGGTAGTGTGTCCGGCGGTACGGTGCTTCCGCTCTCGGCCGGCGGCTCCCAGAATTCACCGATGGCTAG
        TGGACAGCGATCGGCCAGAGGATCGGCCAGTGGTCCCAGTGCTTCCCCGAGCCTTATGGGAGTTGGTCGTGGGCATGGAA
        TCACAGTACCGCGTGGCAGAGTCGTTGGCCAACGTGGCAGCATCAGTCGTCTGGGGGCCCAAACAGTGCCACAGGCGGCG
        GGAGCGGCAGCGGCGGCGGGACAGGCGGCGGCGGCGGTAGCTCAGCGGGGGGCCACCGGTCAGGGGGCGCCGGCAGCAAC
        CGGGGGGTTCCGTGGGGTGTTGCCAACGCGTCCCAGCGCTCGTGGCACCCAGCACGTCAAGCCGCTACAAAATTTACCAG
        TAGTCGGTAAACGTAAGTTCGATGGAGGTCACCAAAATCCGGCAGATGTTAAGCGACGTTACCCGAGCGGTTTAATAGGA
        AATGGCGGCAGTTGGGGCAGTTTACCGCTACCACAGCAACCTTTAGGCACCAATGGTGAACAGTGGTACATGGATACGTT
        TTCGGCATGGAGTTAAAACCACACAGCAACCCAATTGAATCATTAAAAGCATCATTAACGGCAACTACAACAACAACATC
        AACAACAACAGCAACCACACAAGGAAGTTACAGCCAC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0083958
        2301
        FBtr0083959
        8675
        FBtr0083960
        2740
        FBtr0083962
        3146
        FBtr0083963
        6543
        FBtr0083961
        6794
        FBtr0113256
        2214
        FBtr0334711
        3123
        FBtr0334712
        2610
        FBtr0334713
        7374
        FBtr0334715
        3407
        FBtr0334716
        4732
        FBtr0334717
        2862
        FBtr0334718
        3397
        FBtr0334719
        2610
        FBtr0334720
        4448
        FBtr0473514
        3407
        FBtr0473515
        3145
        FBtr0473516
        2884
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0306766
        711
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0083365
        563
        FBpp0083366
        711
        FBpp0083367
        529
        FBpp0083369
        707
        FBpp0083370
        571
        FBpp0083368
        529
        FBpp0112168
        534
        FBpp0306763
        603
        FBpp0306764
        761
        FBpp0306765
        753
        FBpp0306767
        699
        FBpp0306768
        665
        FBpp0306769
        611
        FBpp0306770
        665
        FBpp0306771
        761
        FBpp0306772
        569
        FBpp0423032
        699
        FBpp0423033
        670
        FBpp0423034
        678
        Comments
        Transcript terminates at site supported by polyadenylated cDNA.
        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG17838-RL
        Syp-RL
        Secondary FlyBase IDs
          References (0)