Open Close
General Information
Symbol
Dmel\Syp-RQ
Species
D. melanogaster
Annotation Symbol
CG17838-RQ
FlyBase ID
FBtr0334719
Feature type
Associated gene
Evidence Rank
Length (nt)
2610
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATCGATGCGTAGTTGGCCCTGCTGGGCGATTGTCAAAAGTTATTCCGTAATGTTTTTTGTTTCTATTCAGTTGTGAAAAT
      TTTTCTCGTCTCTCGAATCGTTTCGGAACTATTGATTTTTACTTCAAAAATAAGAAAAAGCGAAAACAAATTCATTCACA
      TTTGCAATCGAAATTCCAAGTCGCCTAAGGAAATTGAAAATTGTTAAATTGTTGCATTACGCGATGCTTTCCCAGATGGA
      AGCCTCCAAAGTGCAGAAGGATGAAGGGGGCGGCGAGGCTCTGAGCCGCACGATCCTCAAAACACCGTCTTCATTCAGGA
      CCCCCAGCCCAATTCCCAGTTGCAGCAAAATGGCGGAAGGTAATGGCGAACTGTTGGATGACATTAACCAGAAAGCCGAT
      GACCGTGGCGATGGCGAGCGTACAGAGGATTATCCCAAGCTGCTGGAATACGGTCTGGACAAGAAGGTCGCCGGCAAACT
      GGATGAGATCTACAAAACCGGCAAGTTGGCTCACGCCGAGCTGGACGAGCGCGCCCTGGACGCGCTCAAGGAGTTTCCCG
      TCGATGGTGCCTTGAATGTGTTGGGACAGTTCCTGGAATCGAACCTGGAGCACGTGTCAAACAAGTCCGCCTACCTATGC
      GGCGTGATGAAGACGTACCGACAGAAGAGTCGAGCCAGCCAACAGGGCGTGGCCGCGCCCGCAACTGTCAAAGGTCCCGA
      CGAGGACAAGATCAAGAAAATCCTCGAGCGCACCGGCTACACATTAGATGTGACGACAGGTCAGCGTAAATACGGCGGAC
      CGCCGCCGCATTGGGAGGGAAATGTGCCAGGCAACGGTTGCGAGGTTTTCTGCGGCAAGATACCCAAGGACATGTACGAG
      GACGAACTGATTCCGCTATTCGAGAACTGCGGCATAATCTGGGACCTACGACTCATGATGGACCCGATGACGGGCACAAA
      TCGTGGTTATGCATTTGTCACATTCACAAATCGCGAAGCGGCCGTCAATGCAGTGCGACAGCTCGATAATCACGAAATAA
      AACCCGGCAAGTGTCTAAAAATAAATATAAGCGTACCGAATCTGCGCCTTTTCGTAGGCAATATTCCCAAGTCAAAGGGC
      AAAGATGAAATTTTAGAGGAATTTGGTAAACTTACAGCTGGCCTATACGAGGTAATCATATACAGTTCGCCAGATGATAA
      GAAAAAGAATCGCGGCTTTTGCTTTCTTGAGTACGAGTCACACAAGGCGGCGTCTTTGGCCAAACGAAGACTTGGCACAG
      GAAGAATTAAGGTTTGGGGATGTGATATAATAGTCGACTGGGCCGATCCACAGGAGGAGCCGGATGAGCAAACAATGTCC
      AAGGTTAAAGTTCTTTATGTGCGAAATCTTACCCAGGACGTCTCAGAGGATAAACTGAAGGAACAATTTGAGCAATACGG
      AAAAGTGGAACGCGTTAAGAAAATTAAAGACTATGCCTTTATACACTTTGAGGATCGTGATAGCGCCGTCGAAGCTATGC
      GTGGCCTTAATGGCAAGGAGATCGGCGCCTCGAATATTGAGGTCTCTCTAGCCAAACCCCCCTCGGACAAAAAGAAAAAG
      GAGGAGATTCTGCGTGCTCGTGAGCGCCGCATGATGCAAATGATGCAAGCGCGTCCCGGGATCGTGGGATTTGAAACCTT
      GTCTCCATACAGAAACCTGTCGCCGACACATCCTAGCATAATGTCCTTGACGCCCATGCGCCCAGGGGCGCGCATGCCGC
      TGCGTACGCCGATACCCCGTGAATACGACTACTTTTACGACTTTTTCGGTTTCTCGGACTATCGCCAAGGGGGGTCCTTT
      GGCAATAATGTGTCCTACTACGATGACATGTACCGCTGGATTGATGGGGATTACAACTACTATGATTACCCGAACGGTGG
      CGGCGGGGGCAGCGGGGGAGGAGGAGGTAGTGTGTCCGGCGGTACGGTGCTTCCGCTCTCGGCCGGCGGCTCCCAGAATT
      CACCGATGGCTAGTGGACAGCGATCGGCCAGAGGATCGGCCAGTGGTCCCAGTGCTTCCCCGAGCCTTATGGGAGTTGGT
      CGTGGGCATGGAATCACAGTACCGCGTGGCAGAGTCGTTGGCCAACGTGGCAGCATCAGTCGTCTGGGGGCCCAAACAGT
      GCCACAGGCGGCGGGAGCGGCAGCGGCGGCGGGACAGGCGGCGGCGGCGGTAGCTCAGCGGGGGGCCACCGGTCAGGGGG
      CGCCGGCAGCAACCGGGGGGTTCCGTGGGGTGTTGCCAACGCGTCCCAGCGCTCGTGGCACCCAGCACGTCAAGCCGCTA
      CAAAATTTACCAGTAGTCGGTAAACGTAAGTTCGATGGAGGTCACCAAAATCCGGCAGATGTTAAGCGACGTTACCCGAG
      CGGTTTAATAGGAAATGGCGGCAGTTGGGGCAGTTTACCGCTACCACAGCAACCTTTAGGCACCAATGGTGAACAGTGGT
      ACATGGATACGTTTTCGGCATGGAGTTAAAACCACACAGCAACCCAATTGAATCATTAAAAGCATCATTAACGGCAACTA
      CAACAACAACATCAACAACAACAGCAACCACACAAGGAAGTTACAGCCAC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0083958
      2301
      FBtr0083959
      8675
      FBtr0083960
      2740
      FBtr0083962
      3146
      FBtr0083963
      6543
      FBtr0083961
      6794
      FBtr0113256
      2214
      FBtr0334711
      3123
      FBtr0334712
      2610
      FBtr0334713
      7374
      FBtr0334714
      2837
      FBtr0334715
      3407
      FBtr0334716
      4732
      FBtr0334717
      2862
      FBtr0334718
      3397
      FBtr0334720
      4448
      FBtr0473514
      3407
      FBtr0473515
      3145
      FBtr0473516
      2884
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0306771
      761
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0083365
      563
      FBpp0083366
      711
      FBpp0083367
      529
      FBpp0083369
      707
      FBpp0083370
      571
      FBpp0083368
      529
      FBpp0112168
      534
      FBpp0306763
      603
      FBpp0306764
      761
      FBpp0306765
      753
      FBpp0306766
      711
      FBpp0306767
      699
      FBpp0306768
      665
      FBpp0306769
      611
      FBpp0306770
      665
      FBpp0306772
      569
      FBpp0423032
      699
      FBpp0423033
      670
      FBpp0423034
      678
      Comments
      Transcript terminates at site supported by polyadenylated cDNA.
      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG17838-RQ
      Syp-RQ
      Secondary FlyBase IDs
        References (0)