Open Close
General Information
Symbol
Dmel\NAT1-RD
Species
D. melanogaster
Annotation Symbol
CG3845-RD
FlyBase ID
FBtr0334772
Feature type
Associated gene
Evidence Rank
Length (nt)
5618
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 202 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATCGATTTTTGTTCCAGCTCTATTTCGTGGAACCTTTGCGTGATTTGCTATACGAAATTACTCAAGAAAAGGATTCCCTA
      AACGCAAGGCCATACCCAGTGTGACGTAACGAAACGGAGAGACGAATCCCAGGTGTTACCACGCAGGACTTGTTACTTCT
      AGCCTAAAGGAACCAACCAGGAAGAACCGAAATCGGAAGGAACAGTAGCAGAGTTGGATAAAAAGCCAGCACCCATAACC
      CATAACTTGTCTCTGTGTGCGTACGCGTGTGTGTGTTAGATTTGTGTGCGTTTCGTCGAGTGTCCCCAAGGATCATCAGA
      ACCACAGAGCAGACGAGGAGGATCTAAGACCCTTAACTAGGATCCAGATCCCCAGAAAACGGGGAAACCAACCAAGACGC
      CAAGAGTAGCCCACTCCGTGCCACCCAAGCACGCACCCATTTCGCCCCCGAGTCGATCAAGAAAAGCATCCACCATTCCT
      CTATCAACGTACGACGCCGCTCCCCTTTTGCACTCTTACGACGACAGTCCGCAACGTTGGTCCGGAGTCACCAACGGGCA
      CCAGGCAGGCGTCATCATAGATCAGTTTCGGGGCGGTAAAGCGATCATCATTGAGGGAGGCACCAGCACCGGTGATACGA
      AGAGCATCGGCGGCGGCAGCGATTTACGACTGGTAATAACGGCCAATCCCAGCGAGATCGAGCGCAATTACGAGCAGCCA
      ACCAATCGCGGTGGTGGCGGAGGCGGCGGCGTTATCGGCGTCAGCTGCGGTGGCCAAACCCCACCGACACCGTCGGTCGG
      CAAAACACTGCTCAACACCAGTCCCAATCTTCTGCCGATCACCACAGCGACCGATACGTTTAACAACCTCAAGAATCTGG
      TGAAGATCGACAAGGGCTCCTCGCCATCGTCAGGATCGAATTCGCTGGGCGGCAATTACCGCAAGGGCGGCTCTAACGGC
      TCAGGATATAAGAGCGCCGGCGGCAACGGAGGATCTCCGGCCATAAGCGGCAACAGCGAGGGCGGCAGGAACGGCAGCCG
      ATCATCTGGTGGACCGACCGGACACTTTTCCACTGGCTATAGTAAGAATTCCGTCAAAATTCGCCAACACGACAGTGAGG
      TGAGCCCAAGACCTCGACGATCTTACCAGGGTGACTCGTCGTCGTCGCGTTACTATCCAAAGAATAGTGACATTTTGGGT
      CAAGGCTTAGGCGGCAACTCCGACAGCTACAACGGCAGTTCCTCTTCTGGTAGATACCAGCAGCAGGATCAGCAAGGCGG
      ATCGCATCGTGGTAGTCGCAGCAACTATCACTCAAACTCCGATGGCAGCTACAATCGATCAATAAACTCAAACTCCGTGG
      GAGGAGGAGGGTCTGGGGCAGTCGGCTCTGGAAGCGGTGGCAGCAATTATCGCTCCGCCCGCAACTACGAGAACGGCAAT
      GGGAGCAACGGCACACAGCCACGTTACGGCAGCGGCAACGGGAACGGCAACAGCAGCAATTCCAACTCTTCATCCGGTTA
      CAACGGATCTGCAGCAAGCTCAACCAACAGCAAGTCGTCGTATGGGGCTTCGCGCGGTGGCAACGATGGAGGCGTGAGTA
      GCGGATACAGCAGCAACTACCGCGACAACTACGAGGATTCACCATCGCACCAGCGCTACAACAACACCAACAGCCTAGAG
      CGAAACGGAGGAGGCGGATCAGGGGCAGGAGCGAGCGGAGGACCCCGCAGCTACGGCAGGTCTGACGCAGATCGTTACGG
      CGGAACCCCGTCCAGTCGCACACCCAATCTTCGCAACGGCAGTGCGTCTGCTCAGATCTCTGGCTCCACTTCCAATTCTT
      CGAACATTTCTCTGAACTCCGGATCAGCGTCGGCCGCAGGAGGAGGCACTCCTCATTCTCAACAGCAGCAGGAACGATCA
      CAGGCTGGCAAGGCAAGCACACCGCCACCGATCACCGGACGCTGGATACCACCATCGTTGCGTCCACAGCATGGACTCAC
      CCAAAGCGAAAAGAACGACGCCGTCTTCCGGCGTGTGAGGGGTATTTTGAACAAGCTAACGCCCGAGAAGTTCCAGGAAC
      TGAGCGATGAACTGTTGAAGCTGGATCTTAACTCTATTGCTATTTTGAAAGGCGTGATTTTGCTGATATTCGACAAGGCC
      TTAGACGAGCCGAAGTACTCGTCTATGTATGCGCAGCTGTGCAAGCGACTTTCCGAGGAAGCCCCGTCATTCGACAAGGA
      ACCAAGCAATTCGTCCACCTTCTTACGCCTGCTGATCGCGGTCTGCCGCGACAAGTTCAACAACCGACTCAAGCGCGACG
      AGAACGACAACAGACCTCCGCCTGAAAATGAGGCCGACGAGGAGGAGCGCCGCCATTTGGCCAAACAGCGCATGCTCGGC
      AACGTCAAATTCATCGGAGAGCTCAACAAGCTGGACATGCTGTCGAAGAACGTGCTGCATCAGTGCATCATGGAGCTATT
      TGACAAGAAGAAGAAGCGTACGGCCGGTACGCAGGAAATGTGCGAGGACATGGAATGCCTGGCTCAACTGCTCAAGACTT
      GCGGCAAGAATCTGGATTCAGAACAGGGCAAAGAGCTGATGAACCAGTACTTCGAGAAGCTTGAACGTCGGTCAAAATCA
      TCTGAATATCCACCGCGGATACGTTTTATGCTAAAGGACGTAATTGAATTGCGCCAGAACAATTGGGTGCCGCGCAAATT
      GGGCACCACCGAAGGCCCCGTCCCCATAAAGCAAATACGCTCGGATGACGACTCAATCATACGCACTCCGTTCCCCAATC
      GCAATCGTGATATGCGCAACAATGATCGTGACTCGGACAGCTGGATGAATCGTTTCCATCTGAATATCCAGCCTGGCGGC
      TATAATGACATGTTTAGCGGACTGAGTGTTACGGGAGCTTCTCCGATTGTCTCGCCGTTCGCTACGAGCAATCGTGACCG
      AGACCGCGACAATCGCCAGTACAACAATCGAGGCGATCGCAACAGGGATCGCGATCAGGGCGGTAGCGGCGGAGCTAACT
      ATGGCAATCGCTACAACAAGCACAACCAGAATGGAGGAGGCAGTGGCGGAGGATCCTCCAACAACCGGGACCGGGATGAT
      TCGCGTAGGAATAACGATCGTGACAGGGATCGCAATGACGGACAGTATGGGGGCAATCAGCTGCTGGGTAGTAAGGAATT
      GGCACCGAGGTTCAAACGCAACTTGATCACCACGAACCAGGATGCGGTGGAGAACTTGCAAATGCGCCCGGCAGCCAACT
      CCTTGCTCTTCCGAGCGGCCTCCCAGAACCAAAAGTTTCCGGCTACGTTGCCCATGTCAACACCGCCCAATAGCAGCGGC
      AGCAACAACCAGGGCAGCTCGCAGGGCCAGCTCTCGAACTCCCACTACCCTATGCTCGGCACGCCCACATCCCATCTGAT
      CAATCCAACGCGTCCCTCGTCAACACCATCTGCTGAGTATGCTGATAACCGAACTCTTTTGGGAGTTCAACAGGAGAGGG
      GATTGAAGGCCACCTCTTCTTCGCCGAACTTTTCATCAGGAGCGGAGAAGTTGGATTTAGACGGTCAGGCGGGCAGAAAG
      GGATCGCACGACGGCAAAGATCAGGGCAAGAATGGCTCCGTGGAGAGACCAAGCACTCCGGCCGGCGGTATTGGCTCGGC
      CAAGCAACAAAAGAAAGATAAGGGTCCCAACAAGGAGGAGCTGTCTAAGAAGGCCAGTCAGTACTTCAAGGATAGGTTCT
      ACTACGATGAGGAGGAGGATGCAGAGGTGACGGAAATTGAGATCAAGGATATTGATGAGACAAAGACGGAGGAGGCCGAC
      GCTGCTCCAGTTGAAGTCTCGGAGGTAAAGGAAGATGCTGCAATACCTGTGACCACTCCAGATCGCTTCACCAAGCTTGT
      AGATGGTTTCCTCGAGCTTAAGCTGCCAGAGAAGGCGCTGAAGGATGTGTGCATCAATCTGCTGATGGAGGTCTTGGACC
      GTGTAAACGATGTCTTCTTGGAGCGTGCTGTGCGCCTTCTGCAGACATTGCGCAAGCAATCCAATATCAAGCCGAACATC
      GTGGTCGAGATTTTCAAGCAGGTGGTCAACAAGATGAACGAGCGAGAGGCACTCAATCCCCGAATCGTTAGTCTTGTAGC
      CAGCTTGCTGGCAAAGACAATTTGCGAGCCAGCATTGCTGAAGTTAAGCGATATCGCCAACTTCACGGACAATGGCCAAC
      ACTATCCGCTGTTCCTGCTCGTGCTGCAGCAACTGGTCAAGGTCATCGGCAAGGATGCGCTGGAAGAGAAATTCCGGGCG
      AGCAAAGTTGATCTTATGAACAGCCTGCCGGAGGCGGATCGGAACAAGGAGCGCTTGGCCGGGATACTCGAGGATCGCAA
      GCTTTCTTTCCTTTATCCGCTATTGAAGGTACAGGCCGAGATGCTAAAACAGCTGCAAAGCGACCCGAACCCCAACAACT
      TCTACAAGTGGATCAAGGCCAACGTTGACAACAAATACTACAAGGACCCGGGCTTTATCCAAGCCCTAATGACCGTGGTG
      GTCAAGTATGTGACCAAGGAGACGACGCTGGCGGACAACCTCGACCCCAAGGAGCACCCTGAGAAATCGGTGACCCAGAA
      GGAGCAACAGCTGCTGGAGAACTACAGCCAGATGCTGCAGACCTTCCTGGGACAGAACGAGCTTCAGTTGATGGCTCTCT
      ATGCTCTGCAAACGTTCTGCTACAATGAAAATTTCCCCAAGGGCATGCTGTGCCGTTGGTTCAAGTATCTTTACGAATCT
      GAAATTATAGAGGAGGAGGCATTCGTCCTGTGGAAGGAGGAGATTTCCGACAAATATCCAGGCAAAGGATCCGCTTTGTT
      CCAAGTGAACGCCTGGTTGACTTGGCTGCAGGAGGCCGAATCTGAGGACGATGAGGATTAGAAAGCAACGCAGTCCCGCA
      TAATAACAGCGCTATATGTTTATCACTTCCAATATTTATTCACAAATCGATAATGATTACATGATGAAAAACAACAAAAC
      TAACAAAACACGAAAAATAAGAAACAAAATACCATCAGGGTGGAAGTTTGAAATCGCGGTTGCAAAACTTAGTCAAATTA
      TAGTAAAAAAGAAAAACAAAACAAAAAAAATTAATCAAAATTATTTGATATCCAACAAATTCAAAGAACATTAACAATCA
      ATTATCAATAAATAAAGCGCAATAGACGTCAAATATAACCGATATTTATCCATACATCATAATTCTCATTGACATTTCAA
      GCATAACGAATAATTAGTGAATTTCATCTTTTTTTTTTAACATAACAACCGGAACTGATCTTTAAATCGAATAACGTTGA
      TTTCAATTGCCTTTTTTTGGTACTCTCGACGATTTCCCTTTTGTGTATTTAAATAAGTAGGTCAAATCAAAGCGACAACA
      TTAACATTATAGAAAAGGAAAAACCAATCGACGCGCGCCGAAGAGAGCAAAACAAAATCTGAATGTAATTGTGAACAAAA
      TATCGTATATATGTATTTAACTCAACCAACGTAAACATTAAAAAACTCGCCCACATTAAATAGAGCCTTAATAAATGCAA
      CCAACACTGCGAACGGCG
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0087786
      5618
      FBtr0087787
      5594
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0306828
      1488
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0086899
      918
      FBpp0086900
      918
      Comments

      Extended CDS supported by conservation across Drosophila species and data in FBrf0184018.

      Unconventional translation start postulated (AUU encoding Met); FBrf0184018; FBrf0218597, FlyBase analysis.

      Transcript terminates at site supported by polyadenylated cDNA.

      translation_exception: non_canonical_start_codon

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      NAT1-RD
      Secondary FlyBase IDs
        References (0)