Transcript Dmel\CoVa-RC

General Information
Symbol	Dmel\CoVa-RC	Species	D. melanogaster
Annotation Symbol	CG14724-RC	FlyBase ID	FBtr0334890
Feature type	mRNA	Associated gene	Dmel\CoVa

Evidence Rank	Strongly Supported	Length (nt)	635
Evidence Score	15

Map ( GBrowse )
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
cDNA Clones Consistent with the Transcript ( 161 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent	DPiM_RE42582 RE42582
cDNA Clones, End Sequence Only (ESTs)
Contained within the annotated transcript, internally consistent	97637 121487 190722 bs50a09 bs81b01 CK01.126C.C7 Dmel_dig_001446_0673_3727 Dmel_dig_002465_0587_3708 Dmel_dig_003531_0674_0552 Dmel_dig_007250_0659_1049 Dmel_dig_008153_0660_1670 Dmel_dig_010746_0653_3308 Dmel_dig_013922_0591_3284 Dmel_dig_015172_0599_1531 Dmel_dig_015749_0666_1437 Dmel_dig_017919_0661_1954 Dmel_dig_018377_0594_2423 Dmel_dig_018430_0702_2992 Dmel_dig_018751_0681_1266 Dmel_dig_020808_0722_0909 Dmel_neb_009876_0915_0483 Dmel_neb_013625_0175_1740 Dmel_neb_013916_0704_1320 Dmel_neb_014365_0186_3464 Dmel_neb_015610_0643_1101 EC14888 EK097012 EK220016 EK241214 EK292960 FGH128F07 FGM105G07 FGM211F07 FGM217F02 FGM220C04 GH06704 GH10803 GH17177 GH25350 GM08812 GM22292 GM22855 GM26855 IP08258 IP10479 RE03141 RE07867 RE42715 RE49264 RE51164 RE52482 RE62470 RE63111 RE75166 RH04841 RH05208 RH06623 RH08213 RH08292 RH08680 RH09405 RH09837 RH10018 RH10288 RH12015 RH14086 RH15102 RH16801 RH17050 RH17053 RH21020 RH21212 RH21734 RH23118 RH24275 RH24682 RH25191 RH29526 RH31132 RH31533 RH32436 RH34181 RH35144 RH35688 RH36057 RH37062 RH37387 RH44234 RH44638 RH45548 RH46220 RH47747 RH48711 RH52127 RH52563 RH54352 RH54405 RH55639 RH55824 RH56051 RH56253 RH58724 RH59064 RH63149 RH63185 RH64073 RH64647 RH65774 RH66642 RH67034 RH69984 RH73270 RH74356 RH74630 RH74686 RH74769 RP003026010 RP003044737 RP003115856 RP003175372 RP003208936 RP003293405 RP003612920
End(s) extend beyond the annotated transcript, internally consistent	AT25240 AT25513 CK01.11B.H8 Dmel_dig_010809_0615_2585 Dmel_dig_013149_0668_3132 EC33785 FGM211F07 FGM323A03 GH05011 GH08142 GH27731 IP07344 IP07444 IP07544 RH09405 RH26362 RH27050 RH29065 RH30074 RH35573 RH36012 RH37117 RH37924 RH39757 RH44765 RH51811 RH58591 RH59452 RH60231 RH61630 RH63430 RH64013 RH65674 RH66346 RH67541 RH68861 RH74082 RP003134961
Sequence
	ACTCAGATCTGTCATACCCGTGTGAAAAGTAGCAAGAACAAGAAAACATG TTGAGCATCACGGCCCGTAACCTGGCAAGCGCCCTCCGCAGCAGCCTCGT CGGCACATCGTCGCGCGTGGCCGCCGTGCGCTGTCTGCACGGAACCGAGG AATCGGCGGAGGAGTTCGACAAGCGCTACGAGAAGTACTTCAGCCGTGAG GGCATCGATGGCTGGGAGATCCGCAAGGGCATGAACGATCTGCTGGGCAT GGATCTGGTGCCCAGCCCCAAGATCATCGAGGCCGGTCTGCGTGCCAGCC GTCGCGTCAACGACATTGCACTGGCCATCAGGTGGCTGGAGGGATGCAAG GACAAGTGCGGCGACCAAAAGGCCACCCTCTATCCCTACTTGCTGGAGAA GATCACCCCCACACTGCAGGAGCTGGGCATCCCAACCATCGAGGAACTGG GCTACGACAAGCCCGAATTGGCCCTGAAGTCCGTGTACGATGCCTAAGCG GAGAACACTAGTTTAAAAACACAGAACACAATATACACGTTACAGCGACA CTAGCTACCTACTATCCAATGTATGGTGCGGATGAACATGTTGTTGGATT GCTAATAAATGGAGATTGCAGTAAGGCTACCACAC
Other Products of this Gene
Other Transcripts
	Name FlyBase ID Length (nt) CoVa-RA FBtr0082473 730 CoVa-RB FBtr0082474 701
Polypeptides
Derived from THIS transcript	Name FlyBase ID Length (aa) CoVa-PC FBpp0306911 149
Derived from OTHER transcripts	Name FlyBase ID Length (aa) CoVa-PA FBpp0081947 149 CoVa-PB FBpp0081948 149
Comments
	Transcript terminates at site supported by polyadenylated cDNA.
External Crossreferences
	RefSeq - An integrated, non-redundant set of sequences • NM_001275559
Synonyms
	CoVa-RC
References ( 1 )
FlyBase analysis	FlyBase Genome Annotators, 2004, Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. Changes affecting gene model number or type in release 3.2 of the annotated D.melanogaster genome. [FBrf0166453]