A Database of Drosophila Genes & Genomes

FB2013_03, released May 7th, 2013
 

Transcript Dmel\CR44108-RA

General Information
Symbol Dmel\CR44108-RA Species D. melanogaster
Annotation Symbol CR44108-RA FlyBase ID FBtr0335050
Feature type ncRNA Associated gene Dmel\CR44108
Evidence Rank Weakly Supported Length (nt) 174
Evidence Score 0
Map ( GBrowse ) GBrowse View Help detailed view FBtr0070825 FBtr0335050 FBtr0290235 FBtr0070827
hide Recent Updates
Description
What does this section display?
This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
Update Feed
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates Click here to see a list of all updates to this record from FB2010_08 and on.
hide cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
hide Sequence
CTCGTTGCCACCGTAGTACCTGCAAGTCAAAGCGATGACCAGGATTAGAG
CAGGATCACCAGGGATTCACATGCCATAGAGCCAATAAGGTGATCTCTAC
CAATCCGTGAGGAATCTTATATGTGCACCCACCTCTTGCCGGGATATCCC
TCGGAGTACTTGTTGGTCAGGCAG
hide Other Products of this Gene
hide External Crossreferences
RefSeq - An integrated, non-redundant set of sequences
hide Synonyms
CR44108-RA
 
hide References ( 0 )
No references are recorded in FlyBase at present.