Open Close
General Information
Symbol
Dmel\Pmp70-RC
Species
D. melanogaster
Annotation Symbol
CG12703-RC
FlyBase ID
FBtr0335156
Feature type
Associated gene
Evidence Rank
Length (nt)
2882
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 23 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTTAAGAAATAACCAAGTCATCACGACTCGTCGCTTTTTCCAGCCTGCAGATAACCAAGGCGCGAGCTTTGTACTTTGT
        TTGGCCTAACATACCAGTAGCACCAGCACCAGCACCAGCACCAGCACCAGCAACACCAGCACCTCACATCTCATCACCCA
        CATTATCCCATAGACTTCGAACCCTGGGCAGGTGGCGATTTTGGACTCCATCCGATTCGATACGATACGATCCGATCCGA
        TCCGATCCGATCCGATTGGCGATCCAATGCCGGTTAGCCAATGGCCCAGTGGCTTGTGTTGAGCTGGTCAGCTCTGGGCA
        CCGGTTTTCATCCGGACCTTGATCCCACAACGATTAGCAGCTGAAAAGAATTCAAACAAATTATCTCGGAAGCATTTCAT
        GTAGCAAATTTGGGGAAATGTGCTTTTTTTTTAATGTACGCTCAAGCAAAAGTGATAACGAAAGCCCATAGCTTAAAACC
        CGGCTATGAGGACAAGATCCAGTACACAATTGCCGAGAAGAAGGATAAGAAGGCGGGAAAGGCGCACGTTAACTCAGTAT
        TCTTCAAACAGCTCCGCCAGCTACTCCCCATCCTCATTCCCGGCTTCTGGAGCGTGGAGACCGGACTGCTCTTCCTGGTG
        GCCGCCGCACTGATTGGCCGCTCGGTGAGCGACATCTGGATGATCCAGAACGCGACGGTGGTGGAGAGCACCATCATACA
        CATGAATCGCACCAAGTTCAAGACGGCGCTGCTCAAATACCTGACAGCTCTGCCAGCGATCTCCGTTGTGACCAACGTCC
        TCAAGTGGAGCTTGGGTGAGTTGAAGCTGAGGTTCCGCACCAACCTCACACACCACCTGTACAGTCAGTACCTAAACGGC
        TACACGTACTACAAAATGTCCAATCTGGACAATAGGATAGCCAACGCCGACCAGCTGCTGACCACGGACATCGACAAGTT
        CTGCGAGAGCGCCACGGACCTCTACTCCAACATCAGCAAGCCCGTGCTGGACATCTTCATCTACGTGTACCGCCTGACGG
        TGAACCTGGGCGGCAAGACACCATCGATCCTGATGCTCTACCTGCTCTTCGCCGGCGTCTTCCTGACACGCCTGCGCCGC
        CCCACTGGTCGCCTGACCGTCGAGGAGCAGAAGCTGGAGGGCGAGTTCCGCTATGTGAACAGCCGACTGATCACCAACTC
        GGAGGAGGTGGCCTTCTACCAGGGCAATGTGCGCGAGAAGCTCACCCTGCTGGCCAGCTACTCCAAGCTGCGTTCGCATC
        TGCGCAAGTTCCTCGAGTTCCGCGTCAGCATGGGCATCATCGACAACATTATCGGCAAATATTTCGCCTCCATTGTGGGC
        TTCTACGCCGTCTCCATTCCCTTCTTCTCCGAAAACCATCCGCTGCTGTCCGGTGAGAATAGCGGCCAGCGCCTGCAGGC
        CTACTACACCTACGGACGCATGCTGGTCAAGCTGGCGGAGGCCATCGGACGCCTGGTGCTCGCTGGACGTGAGATGTCCC
        GCCTGGCCGGCTTCACCGCCCGCATGACCGAGCTAATTAAGGTTCTGAGCGACCTCAACAAGGGCACCTACGAACGCACC
        ATGGTGAACGGCAACAACCTTGCGCAAAACGCCGTCGGATCGGCGTCAAGCAACTTTGGACCAAACAAGGGCATCATGTG
        CTTCGAGGACAACATTATCCGCTTCGAAAAGGTGCCACTGGTGACGCCCAACGGCGATGTACTGCTGCAGGAGCTGTCTT
        TTGAAGTGAAGTCTGGCACAAACGTCCTGGTCTGCGGTCCCAACGGCTGTGGCAAGTCCTCCCTGTTTCGCATCCTCGGT
        GAGCTGTGGCCGACGTGGGGCGGCAAAGTGACGAAACCGTCGCGCGGCAAGCTTTTCTACGTACCTCAGAGGCCCTACAT
        GACGCTGGGAACACTGCGTGACCAGATCATTTATCCACACACGCGCGATGACATGCGTCGCCTGGGACATAGCGACGAGG
        ATCTCATGCACTACCTGGACATTGTGCAGCTGACCTACCTGGAGCAGCGCGAGAACGGCCTGGACTCCATTGAGGACTGG
        ATCGACGTGCTGTCCGGCGGCGAGAAGCAGCGCATTGCGATGGCTAGGCTATTCTATCACAAGCCGCAGTTCGCCATTTT
        GGACGAGTGCACCAGTGCCGTCTCCGTTGATGTGGAGGGCAAGATGTACAGCTATTGCCGCGAGGTGGGCATCACGCTGT
        TTACGGTCTCGCACCGCAAGTCGCTGTGGGCGCACCACGACTACTACCTCCAGTTCGATGGCCGGGGCAGCTACGAGTTT
        GCGACCATCGATCAGGATAAGGACCACTTCGGTTCCTAAAACTAGCAATTTCCATTCTTCAAGCCCAAGCCCGATGATGA
        TCATACCGCTCTGGCTTCTCCTCCTCCTCCTCCTCCTCCTCCATGCGGTGCACTGTATATACCGAGATTGTATATATTGC
        AAGTTGGAAATGCTTCCTTGTTTCGATTGTGATTGTTTCTTTTGTACGCTATTCCACACTATATTCCGTTTTATATAATT
        CCCTCGCTGGGATTTAAGATGTGTAACTCTGAGAATCGAGCTGGTGTTAGTGATGTAAGCGTAAAGTAGTCGGCGCACAG
        CCACAAGCGATGGATGAGCGTTTAGAAAAGCTTTTAGTGAATAACACACCCATACCTGTAGTAGACCTGCATACCGCACA
        AGTCCCAAATCGCGCATAGAGAACTTATAGTAATTTGTAAAATACGCTTGGCTTATTCAAATGTTTTGTATTTTTGGTTG
        AATTGGAATTGGAATGGAACCTTGCACGGCAATAATGTATTGCATTATACAGTGCAAGACGCAATAAATGTATATAAATA
        TG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0074795
        2975
        FBtr0335155
        2728
        FBtr0335157
        3185
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0307155
        641
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0074564
        665
        FBpp0307154
        665
        FBpp0307156
        665
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        Pmp70-RC
        Secondary FlyBase IDs
          References (0)