Open Close
General Information
Symbol
Dmel\Piezo-RH
Species
D. melanogaster
Annotation Symbol
CG44122-RH
FlyBase ID
FBtr0335178
Feature type
Associated gene
Evidence Rank
Length (nt)
9297
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ATTCAGTTCGAAATGTTTTCATCTGCGTTGGTCGTGCGTCCGGTGCTCCGCTAAAAGTAACAAAAAGTGCACAAATTGCC
        GGGAGAAAATGTTACATTAACGATATTTTCGGTTAATGCTGAGCACACGGATACGGATACTACGCTATATACGCAGTTCG
        CAACCAAAATCGATGCAATACGCGGATTTGGGCAAACACAACGCAGTGCCTGTAAAAATCGAAGCCGAAACGAAACAATA
        ACAAATGCGCTAAAGTTCTTACCAAATAATTTGCACCGTCAGAAAAAGAGTGGTGAAAAGTGGTCAAAAGTGATCGAAAA
        GATCTGAAAAGTTCGTTAAAATAAAGAAAGTGTATGGTTAAGTGTGCGTTCCTGGTGATAAATCGGTAAAAATCGTTCGC
        TTTCGTTTTTGTTGTGGTCGCCGTTCGCAGAGCTTATGCAAATGTGCTGCTCTGCGCCGCTTGTGACAACAAATTGCACT
        CGAAGCTGAGGCTTTTATGAATGCTACTGCGTTGGAGTCGGAGTCTGAGTCCGGATACGCATCTGGAGGAGAACGGCGCC
        GGAGGCATCCATCAAAATGGTCTTCAGCTATGCGTGCATGGTGCTCCAGCGCATCGTGGTGCCAGCGGTTCTGGTACTCG
        CTGCCCTGATGCGACCAGTGGGCATATCCTTTGTCTACCTTTTGATGTTCTTTGTGTCGCCCTTTGTTCCGCTGGCCACG
        CGACGCAACTTCAAAGGATCTGTGACTGCCTTCTTCATCATCCTGCTGACGTTGAGCACGCTGGTCCTCTTGGGTCACAT
        AACGCTACAGATTCTGGCGGTCAGCCTCACGCTGCCCATCTACAATTGCTCGTTCAGTGAGCGTCTGCTGCGTCACATTG
        GCTTCGTGAGCTTTATTGATCTACAGCCATTTGCCATCATCGAATGGCTAGTGCCTGAGGTGTTGGTTTTCGCCACCTCC
        CTGGGTTCGTATCTCACGGTGAAGCGAGTGGCCTCACAGCCCGTCGGCGCCGAGCAGCTGGAGAACGGCGAGGTGGTCGA
        TGGCCAGGCGGAAAACGCGCAGACATCTTCTCAGCCATCTGCCGCAGATGCCAATGGAGGAGATGTGCAACAGGCCACGG
        TCACCACGCCGCTGCAGCAACAGCAGCAGCAGCTGAGGAAACGAGTGTCCATGATCAGCCAGCACATACACTTTGAGGGC
        TTGGTCAAGATCTCTCCTCTGTTCTGCCTGGCCACGCTGTTCTTTGCGGCCGTACTGCGTCCCTCGGTGCCTGGCGGATT
        TTACTTTCTCATTTTCCTGCTGTCCGGCACCTACTGGGCAACATGCCAGACGCTGCAACGGGGCTTCGCTTTGTTGCTGC
        GCTGCGTGATGGTCGTCCTCGTGCTGCACTCCCTGTCCATTGTGTCATACCAGACGCCATGGATGCAGAGCCACCTCAAT
        CATACCACCCTGACAGCTCGATTGATTGGACTGGAACCGCTTATTGAATCCTACTGCTCGCCGGATATACGAGTCTTTCT
        GTACAATAATAAGCTATCCCTGGACTCGTACCTCAATCCCTTTGCGTTGTTCTTTGCCTATTTCGCACTGGCACTGACCA
        CCAAGCATCTGATTAAGCCACGGGTTTCTTTGCGCCGAGATCAGCGTGCAACGTTAAATGAACCGACTGAGACGACGCCT
        TTGGTGCGGCAAAGCACGCGAAAGGCACGTACACCCCAACCGCTGGAAAGTGGATCCTCGGTGGCGCCAAGTGTCACTCA
        GCGGGGCAACGACATGCAGCTGGAATCGATGGAGCAGCGATCGGAACAGGAGAACACCACCACATCCATACTGGATCAAA
        TATCGTATGGATTCGTCAGCGTGGGAGGATTCATATATCAGAATAGCTATATATTCACCAATATTCTTATGATGGCCTGG
        TCCATAGTGTATCACAGTTGGCTGACTTTTGTCCTCTTGCTGTCGGCCAACGTACTGTGGATGATTCCCAACCAGAGGAA
        GGCCATGATGCGGTCCAGTCCCTTTATAGTTCTGTATGCTGAGGCCCTTTTGATTGCCCAATACATATACGGCATGGATC
        TCAACAACGAAGAGCTGCCCACGAGCGTTCCCACTGCGGGCATTAACCTGCAACAAATTGGCTTCGAACGACCCATCGAG
        AACCAAATGCGGCCATGTGTGCCGCTGATCGTGAAGACAGCGTTTGTGCTAATGTTTTGGGTGACATCACGACAGTTCTT
        CAAGGAGAAGCGCGATCGCCGACGGGACAGCACTCTGGCGGACTTCATTGCCCCACTGCAGATTACTGTGGGATCGGCTG
        GCTCCAGCTACCTCATCAACGATGGCAAGAAGACCTCAAAGTTCCTAAAGAAGGCCGGCGATGTGATCAAAAATCTATTG
        GTGCGTCTGTGGATCTGGCTACTCGTGCTGGTTATCTTCCTTTGCGCCATCACTGGCGAGAACATGACCGGCTTCCGCAT
        CTGCTACATGGCCCTGTTTCTATTCTTCTTGCTAGTCTTTCAATCTTCGTCCAAGGCGTGGGTTAAGATCATGTACGGCT
        TCTGGCTGTTTCTGATCTTCTATGCCATGTCCATACTTATATTGATCTACACATATCAATTCGACAAGTTCGACACGTAC
        TGGAGCGACTATCTTAATGTGTCCGCGACTTTGCAAAAGGACATCGGCCTTAAGCGCTATCAGACCAAGGATCTGTTCCT
        CCATTTGGTCTCACCGACGATAATTGTGATCCTGACCGTCATACAAGTGCACTACTTCCACAAGCGCTTTATTGCATCAT
        TGCAGCAGCAGCCGTTGGCTGGCGGATCGGCACAGCAGAAACCCACGGAGACAACTGCCTTGGAACCGGCGCCATCGAAG
        CGACGTGGCAGCGCCGGTTCACTGCGTAAATCTCAGGGTCCATCGGCGGAGGCTGCTCCAGGAGCCACCACCGATTTCGA
        GACATCTGTGCGAGACTTGGTGCGCATATCGTTCCGCAAGATCAAGAACAAGTCGGAGTACATCTTCAAGAACTTCAAGG
        ATGTCTTCTGGCGCTTCCTGGAGCTGCACATCATGAAGGCTGTGTATATCGCAGCCTTCGTGTGCAGTGTCAGCGAAGTC
        TGCGTACTGCACATTATCTTTGTGGGTTTCTGTGTGCTGGGCGCCACCTCGCGGAAGGCCGTTCAGGTGGTGATCAGCCG
        CCTCATCTCGTTCATTGTCACCGTCATAGTTCTGTCCAAGATGATCTACCAGATCGAGTACTTGAGTCACTCGCAGCACA
        ATGTGGTTTGTTCTGACAACCGGACTGCCAACAATGCGGAGTGGATTGGTCTCACCAAGGCTGACAAGGTAACTGGCGGA
        CTGATGAGCCTGTTGCGCACCTACATCATCTACATGGTTATTGTGACCATGCACGCAGTGATCAGTTTGCGGCAGCTTCA
        AATGCGCGTCAAGATCGGAGCACTGAATGCTCCACCCACCAAGCTGCTGTTCCCCAATATTATTCGAGCTGATGCTGAGA
        AGGATCTGGTGGGACTGGTCAAGTATCTCCTCAACTTTGGCTTCTACAAATTCGGCATTGAGATATCGCTAATCGCGCTG
        GTCTCTACCATCACATATCGCCAGGATATTGTTGCCGTAGTCTATGCTCTGTGGCTAGTGGTGCTTTTGCTTCTACGGAG
        ATCGCAGTGCGCCAAAATATGGGGCGTGTTTCAGGCATTCTTTGCCATCTCCATACTGACACAGTATATAGTGCTGGTAG
        GATTGCCGCCGAGCTCATGCCTGGTGTTTCCCTGGGATGAAGGTCCCTTCGGCGAGGGCATACAACGCTGGGCGATGCTG
        CCAGGAGCCCTGCACTTCAACCACGTACCCAAGCTGATCTTCGACTTTATTGTCTTGGTCATTCTGAATCGACAGAAGAG
        TATCTTCTGCATCGAACAGCGTTATGCCAGTAACGATGACTACCCGGGTGGCAGCAATCGCAGTGTGATCGCGGATATTG
        CTCAGCTAGGTCGCGTTCCCTTCGACAATCCCACCCACGACTTTTGTTCGTACATACGCAACTACTCGGACATCCTTAAG
        AACGGAGTGCTGTGCGGCTTCTACTGGTTTACTCTGGCAGTTGTTTTCTTGGCCGGCACCAATATTGCTGATCTGCTGGC
        ACTGGGTTATCTGATCGGAGCGTTTATCTTCCTGTGGCAGGGATCGGATTTCTATCTGCGTCCCATACACACCATCATCT
        TTCGCTGGAAGTGGCTGCTGGCATTCAATGTGGCCAACATACTTATCAAGACGTCCTTCCAAATGGCCGGCTGTTTGTTC
        ATGACCCAACTGACGAAAGACTGCTGCTGGCTGGTGCACATGCTCGGCATCACATGTACGAGCAATGTACTTACAGAGCA
        AATAATGCTGCCCGAGGAGGCTGAATTGGCGCTTAAGCCAGGCGAATGTCCTAAGATCACCCACCAGGTGGTCCTTCTGT
        GGGACACGATTTGCTTTGCCTTCATCATCTTCCAGCTGCGCATCTTCAAGTCGCACTACTTCTGTCACATCATAACGGAC
        ACCAAAGCAAATAACATCCTGGCCTCAAGAGGAGCCGACATCATTGAGAGCCTACGACATAAGCAGATTGCACATCGACA
        CGACCATGAAAAGCAGGTGCTGCATAAGATCAAGCGAAAGATGGAGCGCATCCGTGCCACGCAGCAGAAGATGCTACGAC
        CCTTGGACAAACAAACCCACTTCGACGAACATGGTTATCCACTTCCTGCACCAACAGTACGCAGAAGGAAGGAAATTAAA
        TTACATCCACATGCTACCCGTGCTGGTGACTACTATATGTTCGAGGAGATGGACGATAAGTTTGAGCTCGACTTGATACA
        CGACGAGATCGACTTCCTCGAGGAGGAGAACATCACCGAGAGCGAGATGAAGATGCAGCGACGCAAGACCCTCTACGATA
        AGTCGAAGGATGCACCCACAGGCGAGTTTCCCTCCACCAGTAAGGGTATTTCGAAGGAGCGCGATGCGGCAACGGCTTCC
        AGTTCGGCTAGTCCAGCGCCCACTAGGGATGTGGGTGATCTGCCTGTGATTCCACCACCCTCCACTGGCCTGGGACGTGA
        GCAAACCTCCAAGGAGACCTCCGATAGCAAGTCCAAAATGGAAGTGGACAGCGGAGAGGTGACGGCCAAGGATTCGGATG
        AGGACTTCGATACCAATCCCATTATCAGACTGCTCGAGGGCTTCTTGGTCACGCTGACCATAAGACTGAACCGCTTTTCG
        CGCAACTATCGCTTTGTGAATCGCATCCTGGCCGGCGAAAAGAAGACCCTAAAGGAGTCCAGTTCGTTGAACCGTCTGGG
        GCTGTCCAGTGCCGCTGCCATGTTCCACTTCCTCAAATCGAATTTAGAGAGCGATGAAAGTGAACCGCCCGCCTCCTCAT
        CCACCCCGCGGCGGGTGGTGATCGCACCACCGAATGCCACCGAGCACTCAGACCCCACCAGCACCACACTGAACACGAAC
        ACGACAACCACACCGCTATCACCACCAGAACCACTGCAACCACTGCAACCACTGCAACCAAATACAACCAGTACACCACA
        GCAACAGCATCAGCATATTCGCGCTGCCGAAGAAATCATCGAACTGCCTGTAGATACCGTGGATGGAGTCGCCCATAGAA
        AACAATCAATCAATTCATCGCCGCCAGCCAAGGGCGCGGGTGAATTCAATCTGGAGGAGGAGAACTTCGCCCAGAGAGAT
        CATCACATCATTGTCGAGGTGTTGATCTCCTCGTGGTATGCCCTGTTGGCCAACACGGATCTCATCTGCTACATTGTGGT
        TTTCATCAATCAGGTGGTCAATGCCAGTCTCATTTCGCTGCCGCTGCCCATTATGGTCTTTTTGTGGGGCACATTGTCTC
        TGCCGCGTCCCACTAAAACCTTCTGGGTCACGCTGATTGCCTACACCCAGGCCATCGTGCTGATCAAGTGCATCTTCCAG
        TTTAAGCTGATCTGGTCCAATTACCACCAACTGCCCAATCAGCCGCTAACACCGGCCAAAATATTCGGCGTTGAGAATAA
        GGCCCATTATGCGATTTACGACCTGATACTATTGCTGGTTCTATTCCTGCATCGCTATTTGCTTAAATCACAAGGCCTGT
        GGAAATCGGGCTACAAGGACACGGATAACCAGTTCACCAAGCCCACCGCTAGCATTGATGAACGCGACGATAGCGACAAC
        TTATCCCAACCGGATTCCCGCCAGCTAAACGATGATGCTGCTCAGAAGCTGAGTCTCCAAGTGAGCCAGGCTTCCTTGCC
        AGGATCGCCCGAGTTTAGCAAGACAGGCATCAATCAGCTAGAGCGCACCAAGTACACTTCATCGCTGTACAAATTCTTCT
        TCAGTTTGGTCCACAAATCCCGTCTAGCCACAGATGTTTACGCTCTGATGTTCCTCTGCGATTTTGTGAACTTCTTCGTG
        CTTCTTTTCGGCTTCACTGCTTTTGGAACTCAGCAAACGGAAAGTGATGAAGGTGTGCAGACATATCTTGCGGAGAACAA
        AGTGCCCATACCATTCCTGATTATGCTACTTGTTCAGTTCCTGCTCATTGTCATTGATCGAGCTTTGTATCTGCGCAAAG
        CCCTGGTGAACAAGATCATCTTCCACTTCTTTTCGGTTATCGGAATACACATCTGGATGTTCTTCGTTGTGCCTGCAGTT
        ACGGAGCGCACTTTCAACTCCCTCGCACCTCCAATAATATTCTACGTTATCAAGTGCTTTTACATGCTGCTCAGCTCTTA
        TCAAATCAAATCCGGTTACCCTAAGCGCATTCTAGGCAACTTCTTCACCAAGGGTTTCTCGATGGTCAATATGATTGCCT
        TTAAGGTGTACATGCAGATTCCATTCCTGTACGAGCTGCGAACCATATTAGATTGGGTGTGCATTGACAGCACCATGACC
        ATTTTCGATTGGCTAAAGATGGAGGACATTTTCTCGAATATATATCTTATCCGCTGCACCCGGCAGTCAGAGACTGATTT
        TCCGGCCATGAGAGCTCAGAAGAAGGCCTCACTTTCAAAGCTGATAATGGGTGGCACCATCGTCCTGCTGATAGTGATTT
        GCATTTGGGGACCATTGTGTTTGTTTGCACTTGGCAACGCGGTGGGCACCTCGAATGTGCCGTTCCATGTGTCGCTATCA
        ATACGAATTGGACCCTATGATCCCATCTACACAACGAACAACTACGACAGTATCTTCGAGATCAATCCTGAGATGTACTC
        TCAGATGACTAATGCATACATAAAGGAGAAACAGGCTTTGACGTTTATTGCCGGCTATGATGCAACGGATGTAGCGGCGG
        TTAGACTAGCTGGCAACTCGCCATCTCTGTGGAACATAGCACCGCCGGATAGGCAGCGACTACTAAATGATTTAAGAAAC
        AATCACACGCTGAAGGCCCGGTTCTCTTATTCCCTCACCCGAAAGGCTCCTGCCAAGGGGCTAAAGGAAAATGTGGGCGA
        CGAGCATGCCATATCGCTGGACGAGTCCTTTGAGGGACGAGCAGCACTCATTCACATGCTAAGCGAAACCCATGATGTGG
        AGCCCATTTACAGCAATGGCACCACAAATGGAACCACTCCCGAAGTTGAAGAAGTGGTGGTGATACCCGGAATGATACCC
        AAGTTTATCAAGGTTCTCAATTCGGGCGACGCTGCGGTGGTAAGTGTTTTGAGCCCAAAACACTACGACTACCGACCGTT
        GGTTATCAAAATGCATCGGGACAACGAGACCAATGGGTTGTGGTGGGAGATTCGGGACTATTGCAACGACACCTTCTACA
        ACGAAACTCTATCGAAGTTTGCATACAGCAACTGCACTTCGGGAATTGTGATGTACACGTTCAACGATAAAAAGTTTCCA
        TCCACGTTCAGTTTCCTCACAGCGGGAGGCATCATTGGTCTGTACACTACCTTTGTGTTATTGGCCTCGCGCTTTATGAA
        GTCCTTCATTGGCGGGCAAAACAGAAAGATCATGTTTGAGGATCTGCCCTATGTTGATAGAGTGCTGCAGCTCTGTCTGG
        ACATTTATCTGGTACGGGAGGCATTGGAATTCGCTTTGGAAGAGGACCTGTTTGCCAAATTACTCTTCCTATACCGATCG
        CCCGAAACGCTAATCAAGTGGACGCGTCCCAAGGAGGAGTACGTGGACGATGATGGCGACACCGACTCGATTCCCAGTCG
        AATGAGCGTGCGCCGGCCGGAGCAACTGCAGCCACAGCAACCGCAATAACATAGGCCTAATCCAATCGCTTAACTAAAGT
        AGAGTTTGTTTACGTATTTATTACGTATTGCGTTATCGTAGGTTTCATAGTCTTTTTTAAACGTTTTTATAAGGAGAAAG
        AGAACACAAATCGAAACACAAAAGTACGCATCACCCATTTATACAGTCGTTCGATTTTTTGTCAAAAGTACTGCCCATGT
        GTAAAACTGTGTATTTAGTAACTAAGCGAAAAGTGTTGATGTTTGTTAAATCAAACAATTGCAAATAATAGTAAATTATA
        ATTGCCTAATCAAGGAAATAATTTATTTAAGTTACTTCTAAATAAGTGTAAAAATTGAAGATTAAGTGCGAAAATACTAA
        TAATAATGATGAAAACTCATATTCAGGGAATTTAGCATTTTACAGAAACCGTAAATATAATAACTAACCTAAAGCATCCG
        AGTTATTAAGTAAAAATAGCGATTAAATAATAAATGTTTTATATTTATACAAAAAAAAACAATATCATGTAAAATTAGCC
        ATTGCTTCGATTCGCATACATTTCTATGCTGTTTGCCTAATTGTGCCCTTTACAACTGATTAAATATATTACGTAAATGT
        TATACTGTTTACTACTATATAACTAAATCGATACATATTGCATATATAGAGCGTTGACTTTAGTTTTAGGCATATCACTT
        GACATATTTTTGTATTGAATGCAAATATTATTTGCTTAAATAACTCCTTTCTAGGCAAATTCATATCAAAATGAAAAAAT
        TAAATGATATATAGTGCGTTGGCTTCGAATGGAAATTTCTCCCTTTTGCAATCTCTTAAAATTAGTAAACGCCAACTAGC
        TCGGTATGTTTTTTTTTTATATACCAAAACGAAACTAAAATGATGAATGTAAAAAAAAATGAATTTTTATACTAAGAATC
        GAACAACTTAAAACGTAAATGTAATATGTATGCATCTATTTTTTTAGCGATTCATTTCCAAAATTAGCTTATTAACTGCG
        TGGAATACTTGCGAAAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0335175
        9714
        FBtr0335176
        9600
        FBtr0335177
        9645
        FBtr0335179
        9240
        FBtr0335180
        9389
        FBtr0335181
        9300
        FBtr0335182
        9240
        FBtr0335183
        9186
        FBtr0347414
        10101
        FBtr0347415
        10506
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0307171
        2570
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0307168
        2709
        FBpp0307169
        2671
        FBpp0307170
        2686
        FBpp0307172
        2551
        FBpp0307173
        2621
        FBpp0307174
        2571
        FBpp0307175
        2551
        FBpp0307176
        2533
        FBpp0312564
        2838
        FBpp0312565
        2973
        Comments

        3' UTR based on RNA-Seq and EST data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG44122-RH
        Piezo-RH
        Secondary FlyBase IDs
          References (0)