Open Close
General Information
Symbol
Dmel\PGAP5-RC
Species
D. melanogaster
Annotation Symbol
CG8455-RC
FlyBase ID
FBtr0335190
Feature type
Associated gene
Evidence Rank
Length (nt)
1566
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 21 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTGTTAGTCAACCGACAGCCGCTTGACAGCACTGTTTAATTTATCGAATATTTTAAATTTATATCGGGCCGTTTACTCGT
          TTAAAACGATACTATCGCTGATGGTTTTTCAGCTCTAGAATAAATTTGTTATTATTTTTTTAGCCGGTGAGAAATCCTGA
          AATGCGCTTTCTTTATGCCTGCTTTGTGATCGTGCTGTGCGCCCTGATCTTCTGCGAATATGTGGCGGACTTTGTGGTGC
          TGCAAAAGTGCAAGTGGCCGGAGATAAAGCGAAAGAAGTATGTGGACGATCCGCTTAGGGCAATGATTCTAGCGGATCCG
          CATCTGCTGGGACCGCATCGTGGTCACTGGCTGGACAAGCTCTACCGGGAGTGGCACATGACGCGGGCCTTTCAGGCGGC
          ATCACGTCTGTTCCAGCCCGACGTGGTCTTCGTCTTGGGCGATTTGTTCGACGAGGGCGACATGGTCAGCGACAAGCAGT
          TCCAGGAATATGTGTGGCGCTACCTGAAGATGTTCCACCTACCACCGGGAATTCCGCTCATCAGTGTCGCGGGAAATCAT
          GACGTGGGCTTCCATTACAAAATGCATCCCTTCTTTATGTCGCGTTTTGAGAGTTATCTGAACAACTCCTCGGTCAATTT
          GTACACCATTAAACAAATCCATTTTGTGGTGATAAATTCGATGGCTATGGAAGGTGATGGTTGCATGTTTTGCACCCAGG
          CCGAGGATCAGTTGAAAAACATTTCGAGGACTTTGTACTGCATGAAGTATCCACTAGAGGCGGAGTGCGCTCGCACCAGG
          CGGCACCCGTACAGCCAGCCAATTCTATTGCAGCACTTTCCCACCTACCGCATTTCGGATACCATGTGCGAGGAGCACGA
          TGCTCCGTACATCGAGGCGTTCCGAGAGCGGTTTCATGTGCTCTCCAAGGATGCCACGGATATGCTGGGAGAGCTGCTTA
          AGCCAAGGCTGGCATTCGCCGGTCATTCACATCACTTCTGTCACAGTGTAAATCGACTGGGCATCGATGAGTACACGGTG
          GCCTCATTCAGCTGGCGAAACAAAGTTAATCCCAGCTTTATGCTGGCCACTATAACCCCCGATGACTATGTGGTTTCCAA
          GTGCAAAATGCTGCCACAGCAGTTTGTCTTCAATAGCTATCTGAGTGCTGGCATTCTTTGCCTAATTGTCATCGGGTTCC
          AGCTACGAAAGTGCATCCAAAGCAGAAGACAGTCGTCGGCTGTAGATCATCGGAAGGTTAATTAACTAGATACGCCAGAT
          TCCAGACTCAGATCCCAGATCCAGATCCAGACAGAGGTCATATCATTCCTGCTGCTTTGCAACCGCTTAACTATATTCTA
          GGTGTACAAAATTCGGATAGTATGTATGATCTATTTATTGAATTTATCACAGACATTATGCTTGTAAAGTCAAACGGAAT
          ACATAATGAGACACAGTCTGCTGACTACAAATCGAAAATGCCAAAAAAATAATGCTTGAACAAAGGCTGGAAAGTAAAGA
          ACGGATACAAACAGAACAATTAAATAAAGCTATATTATAATACATT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0079587
          1565
          FBtr0079588
          1500
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0307180
          367
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0079208
          367
          FBpp0079209
          370
          Comments

          software_exception: stop codon spans intron

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG8455-RC
          PGAP5-RC
          Secondary FlyBase IDs
            References (0)