Open Close
General Information
Symbol
Dmel\wrd-RP
Species
D. melanogaster
Annotation Symbol
CG7913-RP
FlyBase ID
FBtr0336466
Feature type
Associated gene
Evidence Rank
Length (nt)
2870
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 9 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AACTCTATTTTCTATTGAGCACCGACAACGTTGCGTGTATAAGACAGTTTACATAAATTATTATTTACAATTGCACAGAG
          CGTTGATGTTGTGCGTTCTAAGCGAAAAGGTGAACTTGACCCCGGTGCCGATAGACCGCCGAGCTATTGGGTGTGAAATT
          CGCGAGCGAGCCTTGTGGAATTCGCACGCGAAAATCGAAGCGAATCGCAGCGATCGAAGAAATTGCAGCGCAAATAATTC
          GTGTAGCCTCGACGACTGAATTTTAACGCGAGAGCGGGGTGTGCGTGTGTGTGTGTGCGCTGTGCTGTGATTCTGTGTGC
          GTGTGCAAGCGTTTTTGTTAGAATTCGCATTTTACGCAAAGAACTAGCTTTTATCAGCAGTGAACTTGATGTTGGCGAAC
          CTATATCGCAGCAGGGCCAAATTGAACAAGTTCTTGCAGCTTCTGGCGTGCAAATATAATTTTCAGATAGCAATCAACTG
          AGAGCGGTCCAGCCCGGCCTGTTGTATTTGTTTGTTTGTCCGGTTGTTTACGTTTTTTTCTCTCGTTCTCGCTGCTTTTC
          ATACGTATTTTATATTTTGTAAAAATAAAAAATCGTTATAAAAAACCAAAAACACACATAGAGGAGAGCACATCCAAAGA
          GCCAAAAAGAGTCAGAACCGATTGCGTATTATGGATAACGAGGCGTTAGATCCAACAATAAAAAGCAGTACGTCGGCAGC
          GACGCCAACAGCAGCAGCATCAGAAACGACAACAACAGCAGCATCTTCAGTTGTGGAAACCACAACAACAATCGCGGCGG
          CCACAGCCTCAGCGGCAGAATCAAAAAACGAAACAACGGCCACAAACAACAATAGCAACACAAGCGGCAGCATCAGCAGT
          AGTAGCAGCAACAATATAGTCATACCGGCATCGGCCACTAACGGTATCAAAGAGAGTAACAGTAACTTAAGTACAACAAC
          AACAGCAGCAGCAGTAGCGGCAGCAACAACTGTAGAAGGAGTAGCTCCAGCAATAACGTCCACAATCGTGGTGACCGGCG
          GCACTCCTCCATTGAGCAGTTTGGCAGCTCAACTTAGGCGTCAAGGATTCGCACAGTCCAAGGCTAACAAACTCAAGGAC
          AACACACCACCGTACGATGCACCGCCGCCCACGCCGATCAGCAAGGTCCTGAACATCACCGGCACCCCGATCGTTCGCAA
          GGAGAAGCGCCAGACCAGCGCCCGGTACAATGCCTCCAAGAACTGCGAACTGACGGCCCTCATTCCGCTAAACGAGAAGA
          CCGCCGCCAGTGAACGTGAGGAGCTGTTCATACAGAAGATCCAGCAATGCTGCACACTGTTCGACTTCTCCGAGCCGCTC
          AGCGACCTCAAGTTCAAGGAGGTGAAGCGGGCGGCTCTGCACGAAATGGTCGATTTCCTCACCAACCAAAATGGCGTAAT
          AACCGAAGTTATTTACCCGGAGGCGATCAATATGTTTGCTGTCAACCTTTTCCGAACTCTGCCGCCATCGTCCAACCCGA
          ATGGTGCCGAATTCGATCCGGAGGAGGATGAGCCCACGTTGGAGTCCTCGTGGCCGCATCTGCAACTCGTTTACGAGCTG
          TTCTTGCGCTTCTTGGAGTCACCAGATTTTCAACCAAGCATGGCAAAACGTTTTATCGACCATCAATTTGTATTACAACT
          ATTGGATTTATTCGATTCGGAGGATCCACGTGAACGTGATTTCCTGAAGACTGTTTTACATCGCATCTATGGAAAATTTT
          TGGGCTTGAGAGCATTTATTAGAAAGCAGATCAACAATGTCTTTTACAGATTTATTTATGAAACGGAGCATCATAATGGC
          ATAGCCGAATTGTTGGAAATCCTGGGTAGCATTATCAATGGCTTTGCTCTGCCGCTTAAGGAGGAGCATAAACAATTTTT
          ACTTAAGGTATTGCTGCCATTGCACAAAGCCAAGAGCCTCTCGGTCTACCATCCGCAGCTCACCTATTGTGTGGTGCAGT
          TCCTGGAGAAGGATCCTAGCTTATCGGAGGCGGTCATCAAAAGCCTACTTAAATTTTGGCCCAAGACGCACAGTCCCAAG
          GAGGTTATGTTTTTGAACGAGCTGGAGGAGCTGTTGGACGTAATTGAGCCGGCCGAGTTCCAGAAGGTGATGGTGCCGCT
          GTTCCGCCAAATAGCCAAGTGCGTCTCTTCGCCTCATTTCCAGGTGGCCGAACGTGCGTTGTACTATTGGAACAACGAGT
          ACATTATGTCGCTGATAACGGATAACTCGGCGGTGATATTACCCATTATGTTCCCAGCGCTCAATCGCAACTCAAAGACG
          CACTGGAACAAGACCATCCATGGTCTGATCTACAATGCACTCAAGCTGTTCATGGAGATAGATCAGCGGCTTTTTGACGA
          GTGCAGCAAGAACTACAAGCAAGAGAAGCAGATGGAGCGTGAGAAGCTGTCGCAAAGGGAGGAGCTCTGGCAACAGGTGG
          AGAGCTTGGCCAAGACCAACCCGGAGTGGACAAAGGCGCGCCGGTTTAACGACTGCCTGCCGGTCAGCGACAGCCGGGCC
          CTGTGCGATCAATATAGTGAGAACAGCGATTCAGCGTATGATCAGAGCGAGCAGAGGGCGCGCCAGCCGCCGCCTCCGCT
          GCCGCCACAGAAACAGGCGCACCAGGAGCCCCGAGAGGTGAGACAGGCACTTGCCACATTAACAACACTAAACAACTACT
          AATCCGCCACGTGTGATCCTGGCGTCGCTGTGAGCTGTGCCCAGCTAAGGCCCACTCTGTTTCAACTCTAATTCTAATCG
          AACGAATGTCTGTTAAAATAATCACACTCATGTCATTTAAAAAAAAAAAAATACATATTTGTATATCTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0083555
          3269
          FBtr0083556
          3549
          FBtr0083554
          1823
          FBtr0083552
          2321
          FBtr0083553
          2494
          FBtr0290321
          1704
          FBtr0290320
          2831
          FBtr0290319
          3572
          FBtr0305032
          2453
          FBtr0305033
          2280
          FBtr0305034
          2727
          FBtr0306646
          4402
          FBtr0336467
          3380
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0307569
          683
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0082977
          951
          FBpp0082978
          984
          FBpp0082976
          554
          FBpp0082974
          670
          FBpp0082975
          670
          FBpp0288760
          438
          FBpp0288759
          703
          FBpp0288758
          656
          FBpp0293569
          670
          FBpp0293570
          670
          FBpp0293571
          670
          FBpp0297601
          656
          FBpp0307570
          716
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          PP2A-B'-RP
          wrd-RP
          Secondary FlyBase IDs
            References (0)