Open Close
General Information
Symbol
Dmel\RluA-2-RE
Species
D. melanogaster
Annotation Symbol
CG6187-RE
FlyBase ID
FBtr0337003
Feature type
Associated gene
Evidence Rank
Length (nt)
1988
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTGGTTCGCGCGCTTATCGATAGGCAATGTTTTGGTTTTGCTTGCTTTCGGCATAAAAACGTAATTTTCATGCGGTT
          TTTGCGGCAATTTAGGGACGTTTTTCGTTTGGCAAGTGGTGTTTGTGTTATGAATTAAAGTAACATTTAACTCATTCAAT
          TGAATCATCGCATAAAGCAGAGTGTTTTTGTGTTTGAAACTGAAATCTGCGCACGTGTTGACTAACTTGTTGTTATTATT
          ATAGCGTTGCTTAGATATTCTAGTAAATTGGCCGCAAATCAAAAACTATAAACAATTCTCGTGGCTGTTGAAAATGGAGA
          GTTCCAAACTCTTGAGAAATGCACAAACCCAGCATGGAGATGCCTCATCCGTGGACGTGGAAAACATATTCCTGCACCGC
          CATATGCTATACACAAATCCCACTTCGGATGGCAATCTCCATGATCGGGAAGATTCCCCCGAATGCGTGTGGTGTCCAGA
          CGACAAGGATGGTAGTCCAGCTGAAAGCAAAGATCCACCGATATCCATATCAGAGGAAAAGTCTGAAACGCAATCAAAAG
          AAGTTTTGTCGGAAAAGCGAAAAGCTAGCAGCACAGATGACGAAGGGCATGTGAAAAAAGTAAAATTAGAGGCCAATAGT
          CTAAAAACGAAGCGTCCTGGATTCAGCGATGAAAGATACGACGAAACATCGTATTATTTTGAGAATGGTCTGCGGAAGGT
          GTATCCTTATTTTTTCACATTCACCACGTTCGCCAAAGGACGTTGGGTTGATGAGAAAATTCTGGATGTATTTGTCCGCG
          AATTTCGAGCCGCACCGCCGGAGGAATATGAACGCAGCCTGGAAGCGGGAAAATTGACTGTTAACTCTGAGAAAGTGCCC
          AAGGACTATAAAATCAAGCACAATGATCTGCTGGCCAATGTGGTGCATAGCCCATCAAGATTGTGTACATGGACAAGGAT
          ATTGTGGTTGTGAATAAGCCGGCATCGATACCGGTACATCCTTGTGGAAGATATAGACACAACACGGTAGTTTTCATCCT
          GGCCAAGGAGCACAATCTGAAGAACCTGCGAACCATTCACAGATTGGATCGTCTCACATCTGGCCTACTTTTGTTTGGAC
          GGACTGCTGAAAAAGCCCGCGAATTGGAGCTGCAAATCCGAACTCGCCAAGTGCAAAAGGAATACGTTTGCCGCGTTGAA
          GGACGCTTTCCAGATGGCATAGTTGAATGCAATGAGAAAATCGACGTCGTGAGCTACAAAATAGGTGTTTGTAAGGTTTC
          ACCGAAGGGCAAGGACTGTAAGACCACATTTAAAAGAATCGGCGAGGTGGGCAGTGATAGTATTGTTTTGTGCAAACCAC
          TAACAGGACGAATGCACCAAATACGAGTGCATTTACAATTCTTGGGCTATCCCATTTCAAATGATCCTTTGTACAACCAT
          GAAGTTTTCGGTCCATTGAAAGGAAGAGGAGGAGATATCGGTGGAATAACCGAGGAACAGTTGATCAGTAACCTAATTAG
          CATTCATAATGCAGAAAACTGGTTGGGCTTGGAAGGAGATCAAATCGTATCAGGGGAAATAAAAGACGTAGCAGCAAGTA
          CTTCAGTAGTAGAGGCTCCCTCAGTAGTTCAGGCTCCTATTAATAGTGAAACTGAAAAGCCTGTGATTTCAAAAAACCTT
          GAACCAAGTAACGATGCTACTGCACAGATTGCCACCCAAACGTGCTATGAGGAACCAGACAGGTCCTTTGATTCCAAGAA
          GACAACTTCGGATCCGCAATGTTCTGAATGCAAGATAAACTACAGAGACCCCGGCACAAAGGATCTCATAATGTACTTGC
          ATGCATGGAAATACAAGGGCGTTGGTTGGGAGTACGAAACCGAATTGCCGGAATGGGCGTGTAATTCGAATATTGATTAC
          GATAAAGTATAAAGGAAAAATTGATTGCAAACACGACGCTTTAGTAAAAAGAAATATTTTTACAGAGT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0080032
          2013
          FBtr0304133
          2001
          FBtr0337002
          1880
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0307933
          219
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0079622
          547
          FBpp0293073
          543
          FBpp0307932
          547
          Comments

          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          RluA-2-RE
          Secondary FlyBase IDs
            References (0)