Open Close
General Information
Symbol
Dmel\CG11755-RB
Species
D. melanogaster
Annotation Symbol
CG11755-RB
FlyBase ID
FBtr0337072
Feature type
Associated gene
Evidence Rank
Length (nt)
816
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 3 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          CGAACTGTCAATTCCAAATGTTATGAACCGGGTGCCAAAAAATCAGTTCCTTGCTCGACTTTGTTTTGAGTACCAAATTT
          AAGTTTCTGCTGCTAGATATATCGAATAAGTTTAATCAAATTTCCAGCACAAGAAAATCTCAGACATGGATCCCGATGAC
          GACCTCGTCCTGGAGAATGAGGCAGAGGAAATTGAACGGTTACAGCTTCCCGAGGAGCTTAAAAAGCCCATTGATCCCGA
          GGAAGAGGATGAACGAGTAGCACGCATCGAATTCAATTGTTCTGGCTGTGAAATGCACGAGATGGTCCATTATTTTGGAC
          GGAAACCGCCCTTTGCTCTAGGAGTCATATACCCAGAGGACAACTACGTGATGCGAGATCCTTTCCAACCACCTCCACCT
          CGTTGGCAGTCAAAGCCGGAATACTATATCGCAATGGGGACTAAGTGCTCCATCTGCTCCAAGACGGTGTGCAAGGATCC
          TGGCTGCAGTTTCTACTATACAGCCTCTTTTTGCTTGCCTTGTGGCAAGGAAGAATTAAAAAACTGGCCACCTGAGGCTC
          AAGCTCGAATAAGAAAACAAATGTCTGTCAGTCAAGGCAGGCAAACATAAATTAGTCTTTAAATATAAAACAGTAGTATG
          TAAAAATTATCTAAATAAGCAGTGAAAGAGCTATTGGCTAGAAAGGATACATTTTAAACTTTATTCAATAATGGAAACTC
          GCACTTATTCAAGTGCGGTTGATTGTATTGTTTGTATTGTATGCTTTCTAATGCTTAAATATTATTGCAAAGTAAAATAA
          AACCAATCTGAAGTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0081903
          813
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0307997
          154
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0081386
          154
          Comments
          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG11755-RB
          Secondary FlyBase IDs
            References (0)