Open Close
General Information
Symbol
Dmel\CG1941-RD
Species
D. melanogaster
Annotation Symbol
CG1941-RD
FlyBase ID
FBtr0339116
Feature type
Associated gene
Evidence Rank
Length (nt)
1203
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 5 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TCAGTCGCCGGAGGACCGTGCTACCAAGTAGTTCAACTTTCCGAGTTCGAGAGCTCTGACATCATGAAAATCGAGTGGGC
          TCCCAAAGGAGTTCCCATGGAACGGCGTCGCCAGACGTTTGCCATGGCCTTCCTAATCCTATCCTTTATGATACTCTCCT
          TTGGATCCTATTTCTTCGTTGCTGCCGTGCTGTTCTATGGAAGCCTTTTGTGGCGCACCATTATGGTCATCTATTTGGTC
          TACGTCTACGCGAATCACAAGAGAACCCACTCCATTATGGATGGCAATGGCTGGAAAATTAACCGCAACAATTGGCTGTT
          TCGGCATTATCGGGACTACTTTCCCGTACAGCTGGTCAAGACCGCAGAGCTGCCGCCGAATAAGAACTACATTTTGGCCA
          GTTTTCCGCACGGAATTTTGGGGACTGGCATTTCCATTAATATGGGTCTAGACATCTCCAAGTGGCTGCAACTGTTCCCA
          CAGGTGAGGCCCAAGGTGGCCACTTTGGATCAAAACTTCCTGACGCCCATCGTGCGTGGTCTCCTGAGATCTTGGGGCCT
          GGTGTCGGTTTCCAAGGAGGCCTTAGTATATCTGCTAACCAAATCAAACGATCCCAAGCACAAGGACAATCGTGATGGGT
          TCACCTCCAACGCGGTGGCTATTCTGGTGGGTGGTGCCCAGGAGGCACTAGACTCGCACCCTGGCAAATATATATTGACA
          CTGAAGAACCGCAAGGGATTCGTTAAAATGGCCATTAGGACAGGGTCTTCGATTGTTCCCACGTTTTCCTTTGGCGAGGT
          GGACATTCTGGATCAGGTTGCCAATCCACCGAACTCTCGGGTTCGTCGCTTTCAAGACTTTGTAAAGAGGATAACGGGGA
          TATCTCCGCTGATTCCCGTTGGCCGGGGCATCTTCAACTACTCCTTTGGCTTTCTGCCCAACCGTCGACGCATTGTCCAA
          GTTGTTGGCGCTCCCATCGACGTGGTTCAGAGCGATCAACCAGACGCAGCCTATGTGGATAAGATACACAAACAGGTTAT
          TGACGACCTGGAGAAGATGTTCGCCAAGTACAAGGATCAGTACATACCGAACTCCAAGCAGGACAAGCTGATTATACACT
          AGTCGAGAAGTTATTGTCTAAACAATGTGATCAAATGAGTGCTTTATAAGCATTTAATATAAAAATTACGAATTTTATCA
          GGC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0088927
          1262
          FBtr0339114
          1390
          FBtr0339115
          1678
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0308261
          352
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0088001
          352
          FBpp0308259
          352
          FBpp0308260
          352
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG1941-RD
          Secondary FlyBase IDs
            References (0)