Open Close
General Information
Symbol
Dmel\Bub3-RB
Species
D. melanogaster
Annotation Symbol
CG7581-RB
FlyBase ID
FBtr0339148
Feature type
Associated gene
Evidence Rank
Length (nt)
1362
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 103 )
Sequence
TCGCATCTCTTCTCCAGACGCCGTGCAAATTCGGAGTTTGATTTGTTTTAAGCAGTTTCTGTTTGAATTTATTGTTTTAT
TATCCACAAGTTGCTAGCAGAAAACTTGACAAAATGCGTCCCCCAGAGTTCAAGCTTAACAATCCGCCGGAGGACCTGAT
CTCCGCTGTGAAATTCGGCCCCAAATCGAATCAATACATGGCGGCGTCTTCTTGGGACGGAACACTTAGATTCTATGATG
TGCCGGCAAACCAGCTGCGTCAGAAATTCGTGCAGGATGCCCCTCTTCTCGACTGTGCCTTCATGGACATAGTGCACGTG
GTCAGTGGCTCCCTGGACAACCAGCTGCGTCTCTTTGATGTCAACACCCAGGCGGAAAGCATAATTGGTGCCCACGAGGA
GCCCATCAGATGCGTGGAGCACGCCGAGTATGTCAATGGCATCCTCACGGGTAGCTGGGACAATACCGTGAAGCTGTGGG
ACATGCGGGAGAAGCGCTGCGTTGGAACCTTCGAACAGAACAACGGAAAGGTGTACTCCATGTCCGTGATCGACGAAAAG
ATCGTGGTGGCCACCTCCGACCGCAAGGTGCTCATCTGGGACCTTCGCAAGATGGACAGCTACATCATGAAGCGGGAGTC
CTCGCTCAAGTACCAGACCCGCTGCATTCGTCTATTCCCCAACAAAGAAGGCTACGTGATGTCCTCCATCGAGGGACGGG
TGGCAGTGGAGTACCTGGATCACGATCCTGAGGTGCAGCGCCGCAAGTTCGCTTTCAAGTGCCACCGGAATAGGGAGCAG
AATATCGAACAGATCTACCCCGTTAATGCCTTGAGTTTCCACAATGTCTATCAGACGTTCGCCACTGGCGGATCCGATGG
CATTGTGAACATTTGGGATGGCTTCAACAAGAAGCGCCTTTGTCAGTTCCACGAATACGATACCTCCATATCCACGCTCA
ACTTCAGCTCCGATGGCAGCGCCCTGGCCATCGGCTGCTCCTACTTGGACCAACTGCCAGAGACGCCGGCTACAGTGCCA
CATCCGGCTATCTATATACGCTATCCCACGGACCAGGAAACTAAACAGAAATAATGTTATATATACTTGTTTACGGCAAA
GTTTTACATCATTTTTTAAAGTAAGCTACTTAGTATACTCTTTCAATTTTATGCGCGCATCTCTGATGAAACCCCACATC
AGTTTTCCCAGCACAAATAAAAGCTCTATAAAACTCATGACGGAGGCCCCTATATACAGACTTATGATCCCGCCAAAGTT
GGCCAGTAAATCTATATTGGTGTACTTGAGTTTCGTAATGATTTTGGTCATGACACGTTGGCCATAATAAACCTGGGCTT
TT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0085465
1236
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0308293
326
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0084831
326
Comments

Extended 3' UTR based on RNA-Seq and/or EST data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Bub3-RB
Secondary FlyBase IDs
    References (0)