Open Close
General Information
Symbol
Dmel\CG31064-RF
Species
D. melanogaster
Annotation Symbol
CG31064-RF
FlyBase ID
FBtr0339248
Feature type
Associated gene
Evidence Rank
Length (nt)
3504
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 11 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        ACTTTTTGCCAGTCTTACTCAACGCGTACACAACAGGATAACGGTGCAAAATCAAAGCGGCGAGAACTTTCGGTTATTTT
        GTTAATTTCAGAAGTAAAACCCTCTGGAAAAGAGGTTTACAAAAGGAAAAAACCCCTCTAAGGCGTACTTTGAAGCAGCA
        GCGAAATGCGTGGACTTGTCGAGGATACAAAAAGGACCAAGTTGTCGTCGGCGAACAACAACAACCTCAGCAGCACCAGC
        GGCAGCGGTCGCATCAAGTCGAGCAGCCTTGCAACAGGATCAAGTGCCAGCGGCAGCAGCTCGAAGCCCTTGAGAAGTGC
        AGTGAAAACGCCAACATCGGGCAGCGCGACGTCATTGTCGTCAGGAACAATGGCTGCCAAGAAGGCGCCTCAAACGGGGC
        AACAACAAGTAGGCAAGTCTGCAAAGTCCGCCACGGCAGCAACTCCAACTGGCACAACAGCAACAGCAATTGGAGCAACG
        GCAACAACAAGGGCGCAAGCAGCAGCGGCGAAGAGCCAAAAGGGTCAGAATCCACCCTCACAACAAGTGCAGCCGAAACA
        GCAGCCGCCACAACCGCAACAGACACAGCAGCAACCCCTGGTGTTGCAGCAACAACAGGCGAGCAACAGCAGCAATACGA
        TTGCCTTGCCAAAGGCATCGCATGCCAACACCAGCGAGGAGCTAGCCGGCGGTGTCCAGGACACCATTTACCTGTGCAAT
        TTCCGGGTATCCGTCGATGGCGAGTGGCTGTGCCTCAAGGAGCTGCAGGACATTGATGTGGCCGGCGGAACGGGCAACCA
        GGCAGCTCAGACCAGTGAGAAACTGGCAGGCGGCAGTAGTTCCCAAACGGGCGGCTTCGGGTCCAACTACAATGTGGGCT
        CCAGCTCCAGCAAGCGCAACAGCAAACGCTTCTCCGGACTGTCCACCGGCAGTGGAAGTGGCGGCAACGCCGGTGGAGGA
        GGCGGCTTGGACATCACCGACAATGCCCGGGACACGGCGGAAATTGAGCGCAGTAATCTGGTGAATATCTGCAAGCTGGT
        GGTCAAGGAGCTGTTGGAGCAGTCGCTGCGTTATGGTCGCATGCTGGACTCGGATCACCTGCCGTTGCAGCATTTCTTCA
        TCGTCATCGAGCATGTCCTGGGGCATGGATTGCGCCCGAAGAAGGGTCTGCTGGGACCGAGGAAGGAATTGTGGGATCTG
        CTGCAGAGCGTCGAGCATTACTGCCCGGAGGCGCAGGACATTACGGCGAGTGTAAGGGATCTGCCCACCGTTCGTACCCA
        CATTGGCCGCGCTCGAGCCTGGCTGAGGATCGCTTTGATGCAAAAGAAGCTATCGGATTACCTGCAGGCACTCATCGAGC
        ACCGGGAGGATTCACTCTTCGACTACTATGAGCCACATGCTCTGATGATGAGCGATGAGATCGTTGTGATAATGGGCATT
        TTGGTGGGCTTAAACGTGATCGATTGCAATCTGTGCGTCAAGGAGGAGGATCTGGACTCACAGCAGGGCGTCATCGACTT
        CTCGTTGTACCTGCGTTCAAGCTCGAGAAACGCCGATGCGGCTCCAGAAGACAGTGCTCCGCCTGCTCTGCTGGATGCCA
        CTGGGCAGGGCAACATGATTGCGGTGCTGGACCAGAAGAACTACATTGAGGAGCTCAACAGGCATCTAAACGCCACTGTG
        GGCAATCTGCAGGCCAAAGTAGAGTCCTTAACGACCACAAATGCCCTGATGAAAGAGGATTTGGCAATCGCTCGGAATAG
        CTTGTTGGCCTTGCAGGCCGAGAACCAGGCCATGCGACAGTCCACGTCGGCAGGGGACAACAATTCAACTGGTTCGGGTG
        GTTCATCCGACAAGGACAAGGAGAAGGCGTCCGAAGAGCTGGTTGAGGAGCGTCGCAAGAACAGCGAGCTGGAGAAGGAG
        CTCAAATTGCAGGTGTCCCTCAAGGCGGAATCGGACATGGCCATGAAACTGCTGGAGAAGGATATTCACGAAAAGCAGGA
        CACGATAGTCTCACTGCGCCGCCAGCTGGACGATATCAAGCAGATCAACCTGGAGATGTACCGAAAGCTGCAGGAATGTG
        AAGATGAACTCACACAGAAGGGCGAGATGGTCTCGCGCCTGCAAACGAAAGCCTCACAAATTGGTAACATTTTACAATCG
        CTAGAAAAGAAATACGAATCGAAGCTCATCGACCAGCAACACCATGGACCAGGATCGGGATCGGGCACTGGAGCAGGAAC
        TGGAGCTGGGAACGGAGCCATTGGCGGAGACCGATCGCCGAACACGCGGCGACAGCAGAATCTGGAAAAGTTCGAGGCGC
        TCACCAAGAAGCACAAACAGGACGCTGGCCCGCCCATGAAGCGTATGCATCTCAAGATGGACGCCTTTCCGCCCTTCGAT
        CCCAGCAAGTATCGCAAGTCACCGCGCCAGCCGGATGCGCCCAACACGGAGGAACTGCAGCAGAGCAAGGATGCCAAGAC
        GCCCACGTCCGCCAAGTCCCTGAACGATGAGCTAGCCGAGGCGGCGGCTGCGGTGACCCAGCACTTTGGGGTGGATGCAT
        CCCAAAGCGATTATGTCCTGTGCCGCGAGCAGGCCGCCGATGGAGAAACTTAAGCTAAGCTAAGGCTAAATAAGAATACT
        TAAGATACTTAATTTATAAGGCCAGTTTCGGTTTTCACAGAATGAGTTCTACATAAATGTATTAACTTGTTCGTTTTTTT
        TTTTAATTGAAATCTAATCTGAAACTAGTTTAATATATTTACTCAATGTATTTAGTGCCTGACTGCATTTAAACCTAAGC
        ATAAATTCATTTGTTCAACTATTATTTGGCTTTCTAAAGAGATCCTCTTTGAAATAATGATCTATGTAATGTCTGATCCA
        AAGATCAGTCCACTAAAGTTAGCATGTGAAAATCGGAACGGCCTGCATTGCTCTCAACATTCCAAGGACCTGGATCGCCA
        CTCAAAGTCCGGATCCAGGTGCCGAAGGGAAATCAAACTGCTTAACAAGACTCTCAATTCGGGAGACCACAACTAAATGA
        ACACCATAGACAGTGTGTACCATATATAGGATGCCTTTACTCCGTAGACCAGATCCTTTTAGAGGAAAGTATACCAGATA
        CCAGAATTGTTTTGAATAACTTATGTATGCAACCTGTTAGCTAAATTATCTACCCAGAGTCCCCGTAAACAAAGATTATA
        TATGTACGATTATATTGTAACCATACGTCGTTGTATATATGTATAGTGTGATTAAGAGGCTTCAGATGTTTATTATACAT
        ATGTATGTACGTATGGGATACCCACGCAATCGCTTATATTGTAATTATACACTCAGTCTAGTCAAATACAAATAATAATA
        TTATTGTAATTATATACTATGAATAAATATCGAGACTATATGAATCTACAAATCCATGCAATGTACTATACGCGTTGGAA
        CTTCTGCATATATTCTAATCCACGTACTCCTCCAAATCGAACCCAGAGAAATAAAACTTATCCG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0085124
        2985
        FBtr0085125
        2687
        FBtr0085126
        3645
        FBtr0339249
        3111
        FBtr0347560
        3413
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0308355
        815
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0084494
        667
        FBpp0084495
        729
        FBpp0084496
        862
        FBpp0308356
        877
        FBpp0312593
        700
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG31064-RF
        Secondary FlyBase IDs
          References (0)